ID: 1083111116

View in Genome Browser
Species Human (GRCh38)
Location 11:60408247-60408269
Sequence GAGAGTGTAGAATACGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083111116_1083111118 17 Left 1083111116 11:60408247-60408269 CCTTCCACGTATTCTACACTCTC 0: 1
1: 0
2: 0
3: 5
4: 115
Right 1083111118 11:60408287-60408309 AGAGTAATTCTTTTGCATTGTGG 0: 1
1: 0
2: 1
3: 14
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083111116 Original CRISPR GAGAGTGTAGAATACGTGGA AGG (reversed) Intronic
902161172 1:14531531-14531553 GAGGGTGTAGAATGTGGGGAAGG + Intergenic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
908378092 1:63566346-63566368 GAGGGTGAAGAGTACGAGGAGGG + Intronic
908497225 1:64706666-64706688 CACAGTGTAGCTTACGTGGATGG - Intergenic
909543965 1:76823220-76823242 GAGGGTGGAGAATAGGAGGAGGG + Intergenic
911070306 1:93826982-93827004 GAGATTGTGGAATACCAGGAAGG + Intronic
911126466 1:94345241-94345263 GGGTGTGTAGAATCTGTGGATGG + Intergenic
913311445 1:117500250-117500272 GAGAGTGTGTATTACGGGGAGGG - Intronic
914862738 1:151399869-151399891 GAGAATGCAGAATAATTGGAAGG + Intronic
914975810 1:152360293-152360315 CAGAGTGTAAGATACTTGGAAGG + Intergenic
922283872 1:224151470-224151492 GAGAGTCTAGAAAATGTGAAGGG + Intronic
1063103401 10:2971460-2971482 GAGGGAGGAGAATACTTGGAAGG + Intergenic
1064530169 10:16300324-16300346 TAGAGTGTAGCATAAGTGTACGG - Intergenic
1065477534 10:26156835-26156857 GAGGGTGGAGAGTACGAGGAGGG - Intronic
1067042823 10:42964731-42964753 GAGAAGGAAGAATAAGTGGAAGG - Intergenic
1071159838 10:82732889-82732911 GAGAGAGAAGAATATCTGGAGGG + Intronic
1071555529 10:86598590-86598612 GAGAGTGTAGTATATGGAGAGGG + Intergenic
1071706616 10:88006301-88006323 GAGAGGGTAAAAGACTTGGATGG + Intergenic
1073232868 10:101987201-101987223 TAGAGTGTAGAGTGCATGGAGGG - Intronic
1073623278 10:105071068-105071090 GAGAGTGTAGGACTCCTGGAAGG + Intronic
1074042553 10:109806126-109806148 GAGAGTGGAGAGTAGGAGGAGGG + Intergenic
1076283178 10:129267952-129267974 GTGTGTGTAGAATTCGTGGGGGG - Intergenic
1077555215 11:3222647-3222669 GTGCGGGTGGAATACGTGGAGGG + Intergenic
1082754377 11:57058916-57058938 GAGAGTGTGGAATAAGATGATGG + Intergenic
1083044241 11:59718563-59718585 GAGTGGGTAGAATACCTGGCAGG + Intronic
1083111116 11:60408247-60408269 GAGAGTGTAGAATACGTGGAAGG - Intronic
1084741395 11:71141716-71141738 GAGAGTGGAGTCTACGTGCAGGG - Intronic
1084922127 11:72479668-72479690 TAGATTGTAGAATACGTCCATGG + Intergenic
1087113997 11:94503876-94503898 GACAGTGTAGTATTGGTGGATGG + Intergenic
1087214397 11:95479753-95479775 GAGAGTGTAGAAAACAGCGAGGG - Intergenic
1088755809 11:112884319-112884341 GAGAGTGTGGAGAACCTGGAAGG - Intergenic
1089384596 11:118059501-118059523 CAGAGTGCAGAATGTGTGGAAGG + Intergenic
1091675194 12:2484247-2484269 GAGAGTGAAGGATAAGTGGGAGG + Intronic
1092092587 12:5815206-5815228 GAGAGTGTAAAATGCATGGCAGG - Intronic
1094235444 12:28160569-28160591 TAGAATGGAGAATATGTGGAAGG + Intronic
1097620916 12:61938468-61938490 GAGGGTGGAGAATAAGAGGAGGG + Intronic
1105683334 13:22752225-22752247 GAGAGTGGAGAATGGGAGGAGGG - Intergenic
1108827557 13:54433001-54433023 GAGAGTGTAGAAGAAGAGCAAGG + Intergenic
1109047459 13:57431629-57431651 GAAATTGTAGATGACGTGGATGG + Intergenic
1111022079 13:82463740-82463762 GAGAGAGTAGAATAGGAAGACGG + Intergenic
1111563667 13:89986229-89986251 GAGAGTGGAGTATTCGTGAATGG + Intergenic
1112872453 13:103991857-103991879 CAGAGTGTGGAAGACCTGGAGGG - Intergenic
1113556681 13:111241303-111241325 GAGCGTGCAGAAGACGAGGAGGG + Intronic
1113704808 13:112421959-112421981 GAGAGTGGAGAATGGGAGGAGGG + Intronic
1121336263 14:93079318-93079340 GGGTGTGTAGCATACGTGGGTGG - Intronic
1129314023 15:74730344-74730366 CAGAGAGTAGAATAATTGGAAGG - Intergenic
1132677985 16:1128576-1128598 GTGAGGCTAGAACACGTGGACGG - Intergenic
1134998827 16:18759807-18759829 GTGAGTGGAGAGTAGGTGGATGG + Intergenic
1135949108 16:26896274-26896296 CAGAGTGTAGGATACTGGGAGGG - Intergenic
1137638324 16:50006919-50006941 GAGAGTGGAGAATGGGAGGAGGG + Intergenic
1137651672 16:50125722-50125744 GAGAGTGAAGAAAACGTTAAGGG + Intergenic
1139085286 16:63577324-63577346 TAGAGAGTAGAAGACTTGGAGGG + Intergenic
1142217741 16:88838105-88838127 GGGAGTTCAGAAAACGTGGAAGG - Intronic
1145913346 17:28555365-28555387 GAGAGGGTAGAAAAGGTGAAAGG - Intronic
1146623438 17:34418283-34418305 GACAGTGTAATGTACGTGGATGG + Intergenic
1149566529 17:57644374-57644396 GAGAGTGGAAAAAAGGTGGATGG - Intronic
1152056915 17:78036266-78036288 GAAAGTGAAGTATTCGTGGAAGG + Intronic
1154317564 18:13317261-13317283 GAGAGCTTAGGATACGTGTAGGG - Intronic
1155199164 18:23502776-23502798 GAGGGTGTAAAATTAGTGGAAGG - Intergenic
1165311529 19:35031562-35031584 GAGAGTGGACAAAAAGTGGAGGG + Intronic
1165498733 19:36170770-36170792 GCGAGTGTAGAATGTGTGGATGG + Intergenic
925682900 2:6441701-6441723 GATAGAGAAAAATACGTGGATGG - Intergenic
935797210 2:106655040-106655062 GAGAGTGTAGAAAGTTTGGACGG + Intergenic
939175119 2:138739489-138739511 GAGGGTGTAGAACAGGAGGAAGG + Intronic
939862136 2:147433159-147433181 GAGTGTGTAGAATAATTAGATGG - Intergenic
940518877 2:154717235-154717257 GAGAGTGTAGAACAAGTCTAGGG + Intronic
944860860 2:203814795-203814817 GAGACTGTGGAAAACATGGAGGG + Intergenic
1169433950 20:5567782-5567804 TGCAGTGTAGAATACCTGGAAGG + Intronic
1170582639 20:17710778-17710800 GAGAGGGTAGAATAACTGGCCGG + Intronic
1170703810 20:18727364-18727386 GAGGGTTTAGAATTCCTGGAGGG + Intronic
1172216473 20:33239214-33239236 GAGAGTGCAGAAAGGGTGGAAGG - Intronic
1174033718 20:47652234-47652256 GAGAATCTAGAATACCTGGGGGG + Intronic
1174175143 20:48639857-48639879 AAGAGTGTACAATCCGTGGCCGG - Exonic
1177034279 21:16022452-16022474 GTGAGTGTCTAATAAGTGGAAGG + Intergenic
1177064052 21:16407495-16407517 GAGAGTCTAGAAAACCTGGAGGG + Intergenic
1181143512 22:20825874-20825896 AAGAGTGGAGAATAGGAGGAAGG - Intronic
1181676905 22:24460724-24460746 GTGCCTGTAGAATACCTGGATGG + Intergenic
1182099720 22:27649359-27649381 GAGAGGGTAGGATGCATGGATGG + Intergenic
951025624 3:17825607-17825629 GAGAGTTTAGAGTTGGTGGAAGG + Intronic
955660271 3:61291466-61291488 GAGAGTGGAGAGTGGGTGGAGGG + Intergenic
955881209 3:63548078-63548100 GAGAGTGCAGATTATCTGGAAGG - Intronic
957876091 3:86148454-86148476 GAAGGTGGAGAATACGGGGAGGG + Intergenic
959468363 3:106718686-106718708 GAAAGTGGAGAATACCGGGAAGG - Intergenic
963910295 3:150811602-150811624 GAGAGTGCAAAATAAGTGGGTGG + Intergenic
964139572 3:153381484-153381506 GAGAGTATTTTATACGTGGAGGG + Intergenic
967079913 3:186040236-186040258 GAGAGTAAAGAATGGGTGGAGGG + Intergenic
970520048 4:16873891-16873913 CATATTGTAGATTACGTGGATGG - Intronic
974706722 4:65527834-65527856 GAGAGTGGAGAATGGGAGGAGGG - Intronic
977727070 4:100308571-100308593 CTGAGAGTAGAATATGTGGAGGG + Intergenic
977953761 4:103003341-103003363 GAAAGTGAAGAATAATTGGAGGG - Intronic
978076346 4:104535131-104535153 GAGAGTGTAGAAGAGATGGAGGG - Intergenic
978770516 4:112451812-112451834 GAGAGTGTAGAAGATGGGGATGG - Intergenic
978879126 4:113679461-113679483 GAGACTGGAGAATATGTGGCTGG - Intronic
979395875 4:120188587-120188609 GAGAGTGGAGAATGAGAGGAGGG + Intergenic
983222622 4:165056991-165057013 CAGAGTGAAAAATAGGTGGAAGG + Intergenic
985350368 4:189055079-189055101 GAGAGTGGAGGATTCATGGAAGG - Intergenic
992639525 5:78757115-78757137 GTGAGTGGAGAAGACTTGGATGG - Intronic
994669906 5:102753400-102753422 GAGAGAGAAGAAAATGTGGAGGG - Intergenic
1001600036 5:172922764-172922786 GAGAGAATAGAAGCCGTGGAGGG + Intronic
1002269165 5:178058398-178058420 GAGAGTCTACATTACCTGGAAGG + Intergenic
1002415589 5:179119385-179119407 GAGAGGGAAGAAAGCGTGGAAGG - Intronic
1007618517 6:43197020-43197042 GAGACTGTGGAATATGTGCAAGG + Intronic
1010871299 6:81045158-81045180 CTAAGTGTAGAATACTTGGATGG + Intergenic
1013759119 6:113495728-113495750 GTGAGTGTAGAATAGCAGGATGG + Intergenic
1013870969 6:114759204-114759226 GAGAAGGTAGAATACGAAGATGG - Intergenic
1016373628 6:143398671-143398693 CAGAGTGTAGAAGACATGCAGGG + Intergenic
1021949769 7:25763237-25763259 GAGAGGGTGGAATATGTGGGTGG - Intergenic
1024828680 7:53422199-53422221 GAGAGTGGATAAGACGGGGATGG - Intergenic
1028863803 7:95684314-95684336 AAGAGTTTAGAAAACGTGGTTGG + Intergenic
1033478683 7:141716431-141716453 GAGAGGGTAGAAGAAGGGGAGGG - Intronic
1035210428 7:157323981-157324003 GAGAGAGGAGAATGCGAGGAGGG - Intergenic
1040013399 8:42680931-42680953 GAGAGTGCAGAAAAGCTGGAGGG + Intergenic
1041544531 8:59026974-59026996 GGGAGTGAAGAAGAGGTGGAAGG + Intronic
1045494020 8:102693046-102693068 GAGAGTGTGGACAAAGTGGACGG + Intergenic
1048390205 8:133955860-133955882 GAGATTGTAGACTACTTGAAGGG - Intergenic
1058136560 9:101314195-101314217 GAGAGGGCAGAATAGGAGGAGGG - Intronic
1193488797 X:82121221-82121243 GAGGGTGGAGAATAGGAGGAGGG + Intergenic
1193581334 X:83266745-83266767 GAGAGTGGAGGGTAGGTGGAGGG + Intergenic
1195298709 X:103506072-103506094 GAGAATGTAGAATTGGTGTAAGG - Intronic
1196388139 X:115181207-115181229 GAGAGAGTAGAATAGAGGGAGGG + Intronic
1199133348 X:144220754-144220776 GAGAGAGTAAAATAAGTAGAGGG + Intergenic