ID: 1083112258

View in Genome Browser
Species Human (GRCh38)
Location 11:60422849-60422871
Sequence AGTTATCTGAAGAGGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083112249_1083112258 3 Left 1083112249 11:60422823-60422845 CCCCATCCAGCACAGTAACCCCT No data
Right 1083112258 11:60422849-60422871 AGTTATCTGAAGAGGATGGAAGG No data
1083112248_1083112258 25 Left 1083112248 11:60422801-60422823 CCTTAGTCATCAGAAACAATCAC No data
Right 1083112258 11:60422849-60422871 AGTTATCTGAAGAGGATGGAAGG No data
1083112250_1083112258 2 Left 1083112250 11:60422824-60422846 CCCATCCAGCACAGTAACCCCTT No data
Right 1083112258 11:60422849-60422871 AGTTATCTGAAGAGGATGGAAGG No data
1083112246_1083112258 27 Left 1083112246 11:60422799-60422821 CCCCTTAGTCATCAGAAACAATC No data
Right 1083112258 11:60422849-60422871 AGTTATCTGAAGAGGATGGAAGG No data
1083112251_1083112258 1 Left 1083112251 11:60422825-60422847 CCATCCAGCACAGTAACCCCTTT No data
Right 1083112258 11:60422849-60422871 AGTTATCTGAAGAGGATGGAAGG No data
1083112252_1083112258 -3 Left 1083112252 11:60422829-60422851 CCAGCACAGTAACCCCTTTCAGT No data
Right 1083112258 11:60422849-60422871 AGTTATCTGAAGAGGATGGAAGG No data
1083112247_1083112258 26 Left 1083112247 11:60422800-60422822 CCCTTAGTCATCAGAAACAATCA No data
Right 1083112258 11:60422849-60422871 AGTTATCTGAAGAGGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083112258 Original CRISPR AGTTATCTGAAGAGGATGGA AGG Intergenic
No off target data available for this crispr