ID: 1083115286

View in Genome Browser
Species Human (GRCh38)
Location 11:60453411-60453433
Sequence TTAAGAACTTTATAGTTGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 268}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083115286_1083115288 30 Left 1083115286 11:60453411-60453433 CCTATCAACTATAAAGTTCTTAA 0: 1
1: 0
2: 0
3: 20
4: 268
Right 1083115288 11:60453464-60453486 ATTATTTATAAGTGCAACAATGG 0: 1
1: 0
2: 1
3: 30
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083115286 Original CRISPR TTAAGAACTTTATAGTTGAT AGG (reversed) Intronic
904304715 1:29580685-29580707 GCAAGAACTTTAGAGTTGATTGG + Intergenic
905648741 1:39642301-39642323 TTAAGAGCTGTATAATTGACGGG - Intergenic
907613859 1:55903511-55903533 TTAAGAACTTTATATTATATAGG - Intergenic
907941208 1:59089330-59089352 TTAAGAACATGATAGTAGAGTGG - Intergenic
909411283 1:75354729-75354751 TTAAGAGCTCGAAAGTTGATTGG - Intronic
909799327 1:79786128-79786150 TCAAGGACTTTAGAGTTTATTGG + Intergenic
910202149 1:84710683-84710705 TTATGAACGTTATAGATGATTGG - Intergenic
910411146 1:86946272-86946294 TAAAGAATTTTAGAGTTGAAAGG + Intronic
911330786 1:96523469-96523491 TTAAGAATTTTGTAGTTGGCAGG - Intergenic
911392244 1:97259943-97259965 ATAATCACTTTATAGTTGAATGG + Intronic
912628706 1:111228207-111228229 ATCAGAACTTTAGAGTTGAAAGG - Intronic
914839801 1:151239056-151239078 TTAATAACTTTATATTTTAGGGG - Intronic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916441439 1:164829280-164829302 TTCATATATTTATAGTTGATAGG - Intronic
917078560 1:171232988-171233010 TTGAGCACTTTTTAGTTGACTGG - Intergenic
917214631 1:172665251-172665273 TTTAGAACTTTAGAGTTCCTTGG + Intronic
918331217 1:183462609-183462631 TGAAGGACTTTACAGTTGACTGG + Intergenic
918855104 1:189743200-189743222 TTAAAAACTTGAATGTTGATAGG - Intergenic
919278310 1:195450011-195450033 TTAACAACTCTTTGGTTGATGGG - Intergenic
919439778 1:197617450-197617472 TAAAGAACTTTATGTTTGCTAGG + Intronic
919792080 1:201298479-201298501 CTAAGAACTTTTTACTTGGTAGG - Intronic
920249193 1:204611385-204611407 TACAGAATTTTAGAGTTGATAGG + Intergenic
921320494 1:213933941-213933963 TGAAAAACTTTATTGTTGAATGG - Intergenic
921498875 1:215875756-215875778 TTAAGCACTTAAGAGTTCATAGG + Intronic
921980344 1:221250421-221250443 TTAAGGACTTTATAGTCCAAGGG - Intergenic
924227532 1:241934131-241934153 TTCAGAGCTTTAAAGTTGTTTGG - Intergenic
924316051 1:242797737-242797759 TTAATAACTCTTTTGTTGATAGG + Intergenic
1064894039 10:20213702-20213724 TTATGATCTTTAAAGTTGATTGG + Intronic
1065474985 10:26125785-26125807 TTAAAAATTTTATAGTTAAGTGG - Intronic
1065556465 10:26920481-26920503 TTAAAAACTCAATAGTAGATTGG + Intergenic
1068176428 10:53465574-53465596 TTAACCACTTTATCATTGATGGG - Intergenic
1068485008 10:57646613-57646635 TTTAGAACTTTAGAGTTTATGGG + Intergenic
1068898419 10:62234822-62234844 TAGAGAACTTTATATTGGATGGG + Intronic
1069274435 10:66571689-66571711 ATAAGAACTTTATAGATAATAGG + Intronic
1070098977 10:73367216-73367238 TTCAAAACTTTATTGCTGATGGG + Intergenic
1070869083 10:79732363-79732385 TTAAGAACCTTATAGTCCAATGG - Intergenic
1073415221 10:103375515-103375537 TTAAGAAATGTCAAGTTGATAGG + Intronic
1073551119 10:104402624-104402646 TTCAGAAATCTGTAGTTGATAGG - Intronic
1073676610 10:105654490-105654512 TTGAGGCCTTTATAGTAGATTGG - Intergenic
1073751461 10:106532344-106532366 TTTAATGCTTTATAGTTGATGGG + Intergenic
1078343534 11:10521491-10521513 TTAAGAAGTTTATAGTCTAGTGG - Intronic
1078371984 11:10755551-10755573 TTAAGCACGTTACATTTGATAGG + Intronic
1078903076 11:15659724-15659746 TTATGCATTTTATGGTTGATGGG - Intergenic
1079780021 11:24590248-24590270 TTAAAAACCCTATACTTGATAGG - Intronic
1079898455 11:26150523-26150545 TTAAGAAGTTCATAGTTGAGTGG - Intergenic
1080147977 11:29011342-29011364 TGAAGAAATTGATAGTTAATAGG - Intergenic
1080216876 11:29853521-29853543 AGAAGAATTTTGTAGTTGATAGG - Intergenic
1080803232 11:35628350-35628372 ATATGAAATTTAAAGTTGATTGG - Intergenic
1080845556 11:36023831-36023853 TTTACAGCTTTATAGTTGTTTGG + Intronic
1082202394 11:49388436-49388458 TTGATAATTTTATAGTGGATAGG + Intergenic
1083115286 11:60453411-60453433 TTAAGAACTTTATAGTTGATAGG - Intronic
1085328950 11:75631168-75631190 GTAAAAACTTAATTGTTGATAGG + Intronic
1085957105 11:81412000-81412022 ATATGAACTATATAATTGATTGG - Intergenic
1086122881 11:83318524-83318546 TCAAGAACCTTACAGTAGATGGG + Intergenic
1086652630 11:89311649-89311671 TTGATAATTTTATAGTGGATAGG - Intergenic
1087094844 11:94308256-94308278 TTAAGAAGTTAATAATTGTTAGG - Intergenic
1087735735 11:101831012-101831034 TTATGAAATCTACAGTTGATGGG - Intronic
1089313096 11:117572944-117572966 TTATGAACATTAAGGTTGATGGG - Intronic
1090696835 11:129253583-129253605 CTAAGAACCTTATACTTAATTGG + Intronic
1095277634 12:40307737-40307759 TTTTGAACTTTATAATTTATAGG + Intronic
1098717787 12:73853778-73853800 TTAAGTACTTTATAAATGTTAGG - Intergenic
1099220922 12:79912771-79912793 TAAAAATGTTTATAGTTGATAGG - Intronic
1099565450 12:84238322-84238344 TTAAATACTTAATATTTGATAGG + Intergenic
1099741401 12:86639935-86639957 TTAGGAAATTTATATCTGATTGG - Intronic
1100655724 12:96642858-96642880 TTAAGAACTGTTCAGATGATAGG + Intronic
1101138939 12:101775183-101775205 GTAAGCACTTTAAAGTTGTTGGG - Intronic
1101478036 12:105069895-105069917 TTAAGAAGCTTAGAGTTGAATGG + Intronic
1101499071 12:105284541-105284563 AGAAGAACTTTGTGGTTGATTGG + Intronic
1102867739 12:116387386-116387408 TAAAGAACAGTATAGTTGATTGG - Intergenic
1104650737 12:130530614-130530636 TTAATAAAGTTATAATTGATAGG - Intronic
1104726786 12:131082747-131082769 TTAATAACTTCAGAATTGATGGG - Intronic
1105716077 13:23066156-23066178 TTAAGAACTTTAGATTTTACTGG + Intergenic
1106086767 13:26549730-26549752 TTAAGATCTTTAAATTTTATAGG + Intergenic
1107088543 13:36450959-36450981 TACAGTACTTTATAATTGATTGG - Intergenic
1107458994 13:40582867-40582889 TTAAGAAATTTGTGGTTCATGGG - Intronic
1108636807 13:52343494-52343516 TGAAGAAATTTATAGTTATTGGG - Intergenic
1108755791 13:53500639-53500661 TGAAGGACTTTATGGTTCATGGG - Intergenic
1110374417 13:74776194-74776216 TTTAGGAATTTCTAGTTGATAGG - Intergenic
1112484389 13:99807234-99807256 TTCAGAACTTAGTAGTTGATAGG + Intronic
1112633977 13:101194653-101194675 TTAAGAATTGTATAATTGAGAGG + Intronic
1116422949 14:44754362-44754384 TACAGAATTTTATAGTTGAAAGG + Intergenic
1116568029 14:46477012-46477034 TTAAAAACTTTTAAGTTGAAGGG + Intergenic
1116688124 14:48069502-48069524 TTAGGATCTTTATATTTGTTTGG + Intergenic
1117787892 14:59306202-59306224 TTCTGAACTTTAGAGTTGAGAGG - Intronic
1119089434 14:71767003-71767025 TGACGTACTTTATATTTGATAGG - Intergenic
1120772645 14:88397822-88397844 TTAAGAAATGTATACTTTATGGG + Intronic
1122028147 14:98892608-98892630 TCAAGAACTTTACAGATGAGAGG + Intergenic
1122433733 14:101677534-101677556 GTTAGAATTTTATAGCTGATTGG + Intergenic
1202942324 14_KI270725v1_random:163105-163127 TTACAAAATTTATAGTTGTTTGG + Intergenic
1124030862 15:26010323-26010345 ATAAGTACTTTATAGTAGTTAGG + Intergenic
1124801787 15:32839904-32839926 TGAAGAACTGTATACTTGATGGG + Intronic
1125235369 15:37506618-37506640 TTAACTACTCTATCGTTGATGGG + Intergenic
1125880187 15:43186487-43186509 TTAAGCACTTTTTATTTGCTGGG + Intronic
1126480883 15:49118817-49118839 TCAACAATTTTATAGTTAATAGG + Intronic
1126639437 15:50810316-50810338 ATAAGAACTCTATAGTTAGTGGG + Intergenic
1126833255 15:52632110-52632132 TTAAGATGTTTTTAGTTAATGGG - Intronic
1128439083 15:67686811-67686833 TTAAAAACTTTAAAGTTTAAAGG + Intronic
1128820274 15:70646048-70646070 GTAAAAATTTTATAGATGATAGG + Intergenic
1130029661 15:80300363-80300385 TTAAAAACTTTATGTTTGAAAGG - Intergenic
1130201471 15:81832132-81832154 TTAAGAATATTATGGGTGATAGG + Intergenic
1130575173 15:85085705-85085727 TTAAGAATTTAGTAGATGATCGG + Intronic
1133474965 16:6112142-6112164 TGAAGAACTTAATGGTTAATTGG - Intronic
1135237302 16:20769434-20769456 TTATGAACTGTCTAGTTGATAGG - Intronic
1136082035 16:27858528-27858550 TTAAGCACTTTCTGGATGATAGG + Intronic
1137763825 16:50962264-50962286 TTAGGAACTATAAACTTGATAGG + Intergenic
1138617382 16:58180391-58180413 TTAAAAACTATATTGTTGACTGG - Intronic
1139555360 16:67705588-67705610 TTCAGAAATTTATAGATGAATGG + Intronic
1139808379 16:69589853-69589875 TTAAGAACTTTTTAGATGCGTGG - Intronic
1142922806 17:3205905-3205927 TTAAGAACTTTTAAGTTCAGGGG - Intergenic
1144247988 17:13386662-13386684 TTGAGAACTGGATAATTGATGGG - Intergenic
1149148356 17:53527825-53527847 TTAAATACTTTATACTTTATAGG + Intergenic
1151059536 17:71075762-71075784 ATAAGAAAATTAAAGTTGATTGG + Intergenic
1153193129 18:2564846-2564868 TAAAGGACTTTATAGTTTACAGG - Intronic
1156847223 18:41680458-41680480 TGCAGAGCTTTATAGTTCATGGG - Intergenic
1162842489 19:13366591-13366613 TTAAGTACTTTAAAGTTGGCTGG - Intronic
1165678922 19:37756254-37756276 TAAAGAACTTTACTGTTGAAGGG + Intronic
925273200 2:2630008-2630030 TTTGGAACTTTTTATTTGATGGG - Intergenic
926281797 2:11454799-11454821 TTAAAAACTATATATATGATTGG - Intronic
926504574 2:13697486-13697508 TTAAAAAATTTACAGTTGAATGG - Intergenic
927281246 2:21309524-21309546 TTGAGAAGTTTACAGTTTATTGG + Intergenic
930496051 2:52144977-52144999 TTAAGTACATCATATTTGATAGG + Intergenic
930689936 2:54351380-54351402 TTAAGCAGTCTACAGTTGATGGG - Intronic
930868731 2:56148634-56148656 TTGAGAACTTTATAGAAGTTAGG + Intergenic
931878842 2:66544653-66544675 TTAAGAAATTTTCAGTTGTTCGG - Intronic
932094304 2:68833509-68833531 GTATGTATTTTATAGTTGATTGG + Intergenic
932787029 2:74614778-74614800 TTAAGAACTGTACAGGTTATAGG + Intronic
934093492 2:88576213-88576235 TTAAAAAATTACTAGTTGATAGG - Intronic
934962299 2:98687094-98687116 TTAAGTACTTTAAAGTTACTGGG + Intronic
936623669 2:114125601-114125623 TTAAGAATTTTAAAGTAAATAGG - Intergenic
937763914 2:125637185-125637207 TTAAAAACTTTATACTTAAGAGG - Intergenic
937817525 2:126269298-126269320 TTAAGTATTTATTAGTTGATAGG - Intergenic
938071961 2:128313382-128313404 TTAAAAACTTAATATTTGAGTGG - Intronic
940049188 2:149443585-149443607 TTAAGTATTTTAAACTTGATAGG + Intronic
940067885 2:149650062-149650084 TTAGCTACTTTATAGTTGAGTGG + Intergenic
942290304 2:174462871-174462893 CTTAGAACTTTAAAGTTGAAAGG + Intronic
943514850 2:188871935-188871957 CTAATTACTTTATTGTTGATTGG - Intergenic
944819603 2:203416738-203416760 TCTAGAACGTTATAGTTGGTGGG + Intronic
945323502 2:208455293-208455315 TTCAGAATTTTAGAGATGATAGG + Intronic
947157521 2:227177486-227177508 TAGAGAACTTTATTGTAGATTGG + Intronic
947502142 2:230678842-230678864 TTAAGAACTTTATGGGTCACAGG - Intergenic
1169010298 20:2244727-2244749 TAAAGATCTTTATGGCTGATGGG - Intergenic
1169288298 20:4327946-4327968 TTATGAACTTGATAGTTGGAAGG + Intergenic
1169471782 20:5892327-5892349 TTAAGAACTTTACACTTTTTAGG - Intergenic
1169896773 20:10512930-10512952 TTAAGAAATTTAAAGTGGCTGGG - Intronic
1170219636 20:13928550-13928572 TTTAGAATTTTGTTGTTGATTGG - Intronic
1170441366 20:16382764-16382786 TTAAGAATTATATAGTTCAAGGG - Intronic
1171383344 20:24750340-24750362 TTCAGGAATGTATAGTTGATGGG - Intergenic
1172552693 20:35814145-35814167 TAAACAACTTTTTAGTAGATGGG + Intronic
1172586662 20:36090128-36090150 TTAAGTACTTTAAATTTGAATGG - Intergenic
1174053326 20:47782339-47782361 TTAAGATCGTTATAATTAATTGG - Intronic
1176580846 21:8523825-8523847 TTACAAAATTTATAGTTGTTTGG - Intergenic
1176875323 21:14121258-14121280 TCCAGAACTTTGTGGTTGATAGG - Intronic
1178617778 21:34148371-34148393 TAAAGAACTTGGTAGTTGGTAGG + Intergenic
1180825959 22:18861747-18861769 TTAAAACCTTTATTGTTGACAGG - Intergenic
1181186775 22:21112804-21112826 TTAAAACCTTTATTGTTGACAGG + Intergenic
1181212427 22:21297692-21297714 TTAAAACCTTTATTGTTGACAGG - Intergenic
1203276101 22_KI270734v1_random:87654-87676 TTAAAACCTTTATTGTTGACAGG - Intergenic
949535378 3:4991648-4991670 TTAACTACTTTAGAGTTTATTGG + Intergenic
949687017 3:6587182-6587204 TTAAGTACTTTATAGATTATGGG - Intergenic
951790339 3:26475922-26475944 TTAAGCACTATTTAATTGATAGG + Intergenic
954507264 3:51089166-51089188 TTAAGAACTTTCTATATGCTGGG - Intronic
955702206 3:61693031-61693053 CTAAGAACTTTATTATTAATTGG + Intronic
957892315 3:86376404-86376426 TCAAGAACTTTCTAGATGTTTGG - Intergenic
958104225 3:89052450-89052472 TTAGGGTTTTTATAGTTGATAGG + Intergenic
958115163 3:89206439-89206461 TTAAGAAATTTAAAGTCAATTGG + Intronic
958840501 3:99198686-99198708 TTAAGAACATTGTGGTTCATGGG - Intergenic
959724663 3:109529721-109529743 TAAAGAACTTTCTAGTTGTAAGG + Intergenic
962454784 3:135554995-135555017 TTCAGAATTTCATAGTTGCTGGG - Intergenic
963366659 3:144343979-144344001 TTAGGAAATTTTTACTTGATTGG + Intergenic
963646774 3:147924706-147924728 TTTAGAACTTTCTACTTCATAGG - Intergenic
963654710 3:148031879-148031901 TTAAGAAGTTAACAGTTCATAGG + Intergenic
964660289 3:159113060-159113082 ATAATAACTTTTTGGTTGATGGG + Intronic
964939926 3:162145882-162145904 TTAAGATCTATAAAGTTGCTGGG - Intergenic
965045149 3:163568492-163568514 TATTGAACTTTATAGTTAATAGG + Intergenic
965053124 3:163677343-163677365 TTAATAACTTGATAATTGTTTGG - Intergenic
965243904 3:166241289-166241311 TTAAGAACTGTGAAGTTTATGGG + Intergenic
967211173 3:187170795-187170817 TGGGGAACTTTATAGTGGATGGG - Intronic
967464960 3:189794282-189794304 CTAAGAAGTTTATAGTTCTTTGG + Intronic
967529710 3:190534436-190534458 TTAAGAACTTCATAGCTGTAGGG + Intronic
967631555 3:191748278-191748300 TTAAAAACTTAAAAGTTGACAGG + Intergenic
968498199 4:930624-930646 TTAAGAAGTTTATTGTGGACAGG - Intronic
969402975 4:6969274-6969296 TTAAAAACTTTATAGCAGCTTGG - Intronic
970168303 4:13263045-13263067 TGAAGATCTTTATACCTGATAGG + Intergenic
970297926 4:14651224-14651246 TTAAGAAGGTTAAAGTTGAAAGG + Intergenic
970730140 4:19093164-19093186 TTTAAAACTGTATAGTTGAGTGG + Intergenic
972086234 4:35220325-35220347 TTAAGATATGTATAGTTCATGGG - Intergenic
972384365 4:38550278-38550300 TTTAAAACATTATAATTGATAGG - Intergenic
972841147 4:42931584-42931606 TTAAGAAATTTATTATTAATTGG + Intronic
975066322 4:70069054-70069076 TGAAGAACTTCATGGTTGTTTGG - Intergenic
976533011 4:86177432-86177454 TTAAAAATTTTATACTTCATTGG - Intronic
978906109 4:114007548-114007570 TTATGCAGTTTATCGTTGATGGG + Intergenic
979449730 4:120856411-120856433 CTAAGAACTTAAAAGTTGTTTGG - Intronic
979816374 4:125111150-125111172 TTATAAACTTTATACTTAATTGG - Intergenic
981521227 4:145664835-145664857 TTTAGCACTTTACAGTTTATTGG + Intergenic
983376283 4:166932855-166932877 TTAAGAACTATCTAATTGATAGG + Intronic
983759812 4:171391879-171391901 TTTTGTACTTTACAGTTGATCGG + Intergenic
985362308 4:189188860-189188882 TTAATAACTTGATATTTAATTGG - Intergenic
986802315 5:11274852-11274874 TTTAGAACTTTCTTGTAGATCGG - Intronic
986891070 5:12306479-12306501 GGAATAACTTTAGAGTTGATTGG + Intergenic
987378848 5:17264854-17264876 GTAGAAACTTTATAGTGGATAGG + Intronic
989413328 5:41144970-41144992 TTATGCAGTTTATTGTTGATGGG + Intronic
991534848 5:67658063-67658085 TTAATGACTTTATGGTTGGTGGG - Intergenic
992202996 5:74402285-74402307 TTAAGAAGTTGACAGTTGAATGG - Intergenic
993135770 5:83960876-83960898 TTAAACAATTTATATTTGATGGG - Intronic
995227375 5:109716681-109716703 TTAAGAACCTTGGTGTTGATTGG + Intronic
995488941 5:112669604-112669626 TAAACAACTTTATGGTTGAAAGG - Intergenic
995503603 5:112835369-112835391 TTAAGCAAATTATAGTTGAGAGG + Intronic
995929173 5:117415363-117415385 TTGAGAATTTTAGAGTTGTTAGG + Intergenic
995976364 5:118040422-118040444 TTCTGAACTTTTTAGATGATAGG - Intergenic
996696069 5:126396563-126396585 TTATGCAGTTTATTGTTGATGGG + Intronic
998932097 5:147192640-147192662 TTAAGAACTTCACAGTTGAAGGG + Intergenic
999518280 5:152322954-152322976 TTATTAATTCTATAGTTGATAGG + Intergenic
1000314829 5:160079897-160079919 TGAAGAACTGTATAGTTGCATGG - Intronic
1004957287 6:20742620-20742642 TTAAGAATTTTCTAGTTTTTAGG + Intronic
1005465809 6:26111656-26111678 TTTTGAACTTTATATTTGATTGG + Intergenic
1005566258 6:27097540-27097562 TTTTTAACTTTATGGTTGATGGG + Intergenic
1008605843 6:53138677-53138699 TTAAGAAGTTTATAATTGAAAGG + Intronic
1009662264 6:66629831-66629853 TTAACAATTTTATGGTTTATAGG - Intergenic
1010156250 6:72797191-72797213 TAAAGAATTTTATAGTTCATGGG - Intronic
1010836643 6:80596325-80596347 TTATGAAGTTTACAGTTGATGGG - Intergenic
1010853520 6:80807958-80807980 GGAAGAAATTTATAGTGGATTGG + Intergenic
1011922472 6:92596894-92596916 TCAAGAACATTATAGGAGATAGG + Intergenic
1012210702 6:96515295-96515317 TTATGAAATTTATAGATGACAGG + Intergenic
1012884246 6:104826320-104826342 TCAAGAAGTTTATAGTAGAAAGG + Intronic
1015741918 6:136465297-136465319 TTAAGAAATTTAAAATTGAAGGG - Intronic
1018053701 6:160033687-160033709 TTAATGAGTTTACAGTTGATAGG + Intronic
1020502428 7:8940303-8940325 TTAAGAACGCGATAGGTGATAGG - Intergenic
1022444845 7:30461476-30461498 TTAATAAATTTTTTGTTGATGGG - Intronic
1023029258 7:36078759-36078781 TTAAGTAATTTAGAGTTGAAGGG + Intergenic
1023094462 7:36646091-36646113 TTAAGAACTCTATAGCAGAGTGG - Intronic
1023396456 7:39756168-39756190 TTAAAAACTTAATTGTTGGTGGG + Intergenic
1023549892 7:41358198-41358220 TAAAGAACTTTATTGTGAATGGG - Intergenic
1024501501 7:50113065-50113087 TAAAAAACTTTATAGTACATAGG + Intronic
1027489836 7:78809257-78809279 CTCAGTACTTTATAGATGATCGG + Intronic
1027854571 7:83493062-83493084 TTAAGAATTTTAAAGGTGAAAGG - Intronic
1028010276 7:85634058-85634080 TTAAAAACTTGATATTTTATAGG + Intergenic
1030696997 7:112596365-112596387 TTAACCACTTTTTAGTTGACAGG + Intergenic
1032369979 7:131339406-131339428 TTAAGAAATTGAGAGTTGGTCGG + Intronic
1032612782 7:133433714-133433736 TCAAGAACTTTATTGTTCAATGG + Intronic
1032888256 7:136165331-136165353 ATAAGACATTAATAGTTGATGGG + Intergenic
1036144183 8:6238254-6238276 TTCAGAACTTTAAAGTTCTTGGG - Intergenic
1037246217 8:16838429-16838451 TAAATATCTTTAAAGTTGATTGG - Intergenic
1039067964 8:33625883-33625905 ATAAGAATTTTATAATTGTTTGG - Intergenic
1039367783 8:36949945-36949967 TTGAGAATTTTATAATTAATTGG - Intergenic
1039652960 8:39363134-39363156 TTGGGAATTTTTTAGTTGATAGG - Intergenic
1039677794 8:39689078-39689100 TTAAGTTCTTTATAGATGCTGGG + Intronic
1040692869 8:49961006-49961028 TTGAAAACTTTCTATTTGATAGG + Intronic
1040732635 8:50468615-50468637 TCAATAACTTTATATTTGAATGG - Intronic
1043324095 8:79028252-79028274 ATGAGAACTTTTTAGTTCATTGG + Intergenic
1043385959 8:79748110-79748132 TTTAGAGCTTTATATTTAATGGG + Intergenic
1043732236 8:83696855-83696877 TTAAGTTCTTTATAGATGCTGGG + Intergenic
1043825232 8:84920166-84920188 CTAAGACCTTTGAAGTTGATGGG + Intronic
1044353985 8:91198879-91198901 GTAAGAACTTTATATTTTAATGG + Intronic
1045102132 8:98855675-98855697 TTAAGAACTTTTGTGTTGAGGGG + Intronic
1045109836 8:98929859-98929881 TTCAGAACTTTGTAGCTGAAAGG + Intronic
1045854726 8:106750709-106750731 TTAATAACTTTAGGGTTGTTAGG + Intronic
1047875687 8:129135116-129135138 TGAAGCACTTTAATGTTGATAGG - Intergenic
1048372212 8:133788959-133788981 TTAAGCACTTTCTATTTTATTGG - Intergenic
1048912237 8:139146902-139146924 TTAAGGATTTTATACTTCATAGG + Intergenic
1050685354 9:8162460-8162482 TTAAGCACTTACTAGGTGATGGG - Intergenic
1050832719 9:10034430-10034452 TTAAGAACTTTTAAGTTCAGGGG + Intronic
1053343391 9:37359397-37359419 TAAAGATCTGTATAGTTGGTAGG + Intergenic
1053361699 9:37492212-37492234 TTGAGTACTTTGTAGATGATTGG + Intronic
1054729195 9:68683829-68683851 TTAAGAACTTTATCATTCACTGG + Intergenic
1055267980 9:74520272-74520294 TTAACAACTTTATATTTGTGTGG - Intronic
1055963205 9:81840638-81840660 TCAAGGACTTTATAGTTTAATGG + Intergenic
1057370415 9:94467482-94467504 TTAAGAAATTTATGATTCATGGG - Intergenic
1059036018 9:110754428-110754450 TAAAGCACTTTATAGTTGCAAGG + Intronic
1060882665 9:127129328-127129350 TTAAAAAATTTATATTGGATGGG - Intronic
1187549673 X:20289588-20289610 TGAAGAACTTTATAACTGACTGG - Intergenic
1188323056 X:28764132-28764154 TAAAGCACTTTAGAGTTAATGGG + Intronic
1188581651 X:31721394-31721416 TTAAGGACTTCAAAATTGATTGG - Intronic
1188961380 X:36496584-36496606 TTTTGAACTTTTAAGTTGATGGG - Intergenic
1191027873 X:55934951-55934973 CAAATAACTTTATAGTTGAAGGG + Intergenic
1192274302 X:69614493-69614515 TTGTGAACTTTATATTTCATGGG + Intergenic
1193437215 X:81490010-81490032 TCAAGAACTTAATAGCTAATAGG - Intergenic
1193602782 X:83528456-83528478 TTAAGAATTTTATAGATGTTTGG + Intergenic
1194721228 X:97342353-97342375 TTAAGAACTGTATAGCTTACTGG + Intronic
1194968374 X:100315657-100315679 TTAAGCTATTGATAGTTGATTGG - Intronic
1195073392 X:101302992-101303014 ATAACAAGTTTATAGTAGATGGG - Intergenic
1195540374 X:106056246-106056268 TTAAGAACTCTATAGTTTGCAGG - Intergenic
1195546812 X:106122516-106122538 TTAAGAACTCTATAGTTTGCAGG + Intergenic
1197127304 X:122961969-122961991 TTAAGATCTACAGAGTTGATAGG + Intergenic
1197467584 X:126823042-126823064 TTTAGACGTTTCTAGTTGATTGG - Intergenic
1197643371 X:128991918-128991940 TTCATAAATTTATATTTGATTGG + Intergenic
1197647326 X:129032206-129032228 TAAAGAACTTGGAAGTTGATGGG - Intergenic
1198951896 X:142081235-142081257 TTAGGAACTCTATAGTTTGTGGG - Intergenic
1199239637 X:145531205-145531227 TTAGGAAAATTATACTTGATGGG + Intergenic
1201913876 Y:19161507-19161529 TTATGAACTTTTTAGTTGGTAGG - Intergenic