ID: 1083119856

View in Genome Browser
Species Human (GRCh38)
Location 11:60500898-60500920
Sequence ACACATCTGAAGCAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 245}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083119856_1083119862 27 Left 1083119856 11:60500898-60500920 CCCACCTCCTGCTTCAGATGTGT 0: 1
1: 0
2: 2
3: 28
4: 245
Right 1083119862 11:60500948-60500970 AAAATTGACAATAAATAAGCAGG 0: 1
1: 0
2: 7
3: 87
4: 1766
1083119856_1083119864 29 Left 1083119856 11:60500898-60500920 CCCACCTCCTGCTTCAGATGTGT 0: 1
1: 0
2: 2
3: 28
4: 245
Right 1083119864 11:60500950-60500972 AATTGACAATAAATAAGCAGGGG 0: 1
1: 0
2: 0
3: 27
4: 377
1083119856_1083119863 28 Left 1083119856 11:60500898-60500920 CCCACCTCCTGCTTCAGATGTGT 0: 1
1: 0
2: 2
3: 28
4: 245
Right 1083119863 11:60500949-60500971 AAATTGACAATAAATAAGCAGGG 0: 1
1: 0
2: 3
3: 60
4: 774
1083119856_1083119860 -4 Left 1083119856 11:60500898-60500920 CCCACCTCCTGCTTCAGATGTGT 0: 1
1: 0
2: 2
3: 28
4: 245
Right 1083119860 11:60500917-60500939 GTGTGCCTGAATGACAACGATGG 0: 1
1: 0
2: 0
3: 5
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083119856 Original CRISPR ACACATCTGAAGCAGGAGGT GGG (reversed) Intronic
900499844 1:2998646-2998668 ACACAGCTGGAGCAGGAGGAGGG + Intergenic
900817900 1:4863918-4863940 ACACATTTAAAGCAGTATGTGGG - Intergenic
901269804 1:7942789-7942811 ACACAACTGAGGCAGGAGAATGG - Intronic
901329605 1:8395565-8395587 AGACATTTGAAGCTGGAGGTAGG + Intronic
901413529 1:9101559-9101581 ACTCATCTGTGGCAAGAGGTGGG + Exonic
901457083 1:9369256-9369278 ACCCACCTGAAACAGGAGGGAGG - Exonic
903727123 1:25457356-25457378 ACACTTCAGAAGGTGGAGGTGGG - Intronic
904089952 1:27937784-27937806 GCACAACTGAGGCAGGAGGTGGG + Intronic
905276144 1:36819451-36819473 CCTCAGCTGGAGCAGGAGGTGGG + Intronic
905453927 1:38074647-38074669 AAGCATCTGGACCAGGAGGTTGG + Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
909389033 1:75096369-75096391 ACAGACTTGAAGCTGGAGGTTGG - Intergenic
909861524 1:80611692-80611714 ACAAGTCTGGAGCAGGAGGAAGG + Intergenic
910169788 1:84365978-84366000 ACACATGAGAAACAGGAAGTTGG - Intronic
910501991 1:87902981-87903003 ACACATCTTCAGGAGGAGGAAGG + Intergenic
911702557 1:100971053-100971075 AAAAAGCTGAAGCAGGAAGTTGG - Intronic
913494817 1:119418754-119418776 ACAAACCTGAAGCAGGAGGAAGG - Intronic
915034615 1:152911358-152911380 AAACATCTGGAGCAGCAGGAGGG + Exonic
918771173 1:188562222-188562244 AGACATCTGAAGAAGGTGGAAGG + Intergenic
922873933 1:228925233-228925255 ACACACCTGAAGCTGGTGATTGG + Intergenic
922929997 1:229381501-229381523 ACACACATTAAGCAGCAGGTGGG + Intergenic
923887296 1:238173248-238173270 ACATGGCTGGAGCAGGAGGTGGG - Intergenic
924158759 1:241208475-241208497 ACACATCTGAGGTAGGTGTTGGG - Intronic
1064116245 10:12579807-12579829 ACACTTCTTAAGCGAGAGGTCGG + Intronic
1065375201 10:25032585-25032607 TTACTTCTGAACCAGGAGGTGGG - Intronic
1066719385 10:38321468-38321490 TAATATCAGAAGCAGGAGGTTGG - Intergenic
1067032492 10:42887781-42887803 AGACACCTGGAGCTGGAGGTGGG + Intergenic
1067107944 10:43377982-43378004 ATACATGTGAAGGTGGAGGTGGG - Intergenic
1068740790 10:60467419-60467441 ACACATCTTTAGCAGGATGTGGG + Intronic
1070557822 10:77542807-77542829 ATACTTCTGAAGCATGGGGTGGG - Intronic
1070661492 10:78309644-78309666 AAACATCTCAAGAAGGAGGTAGG + Intergenic
1072396351 10:95046661-95046683 ACAAATGTGAAGGGGGAGGTAGG + Intronic
1072399808 10:95086482-95086504 AGCCATCTGAAGCTGCAGGTGGG + Intergenic
1073355188 10:102848265-102848287 ACAGTTCTGAGGTAGGAGGTAGG - Intergenic
1073502643 10:103955417-103955439 AAACTTCTGATGCAGCAGGTGGG + Intergenic
1073901460 10:108226751-108226773 ACACATCTGAAGCCAGAAGTCGG + Intergenic
1074394519 10:113086554-113086576 CCACTTCTGAAGCTGGGGGTGGG + Intronic
1075279760 10:121129480-121129502 AGAAAACTGAAGCAGGAGTTGGG + Intergenic
1075336361 10:121611791-121611813 GCACCTCTGTAGCAGGAGGTTGG - Intergenic
1075653176 10:124143388-124143410 ACATCTCTGAACCAGGAGTTAGG - Intergenic
1077462216 11:2716292-2716314 GCACATCTGATGCAGAGGGTAGG - Intronic
1080045797 11:27806346-27806368 CCACATCCGAGGCAGGAGGGAGG - Intergenic
1080346248 11:31329007-31329029 ACCCATCAGAATCAGGAGGAAGG - Intronic
1080701672 11:34649586-34649608 ACACACCTAAGGCAGGAGCTGGG - Intronic
1080826429 11:35852886-35852908 ACACATATGTAGCATGAAGTAGG + Intergenic
1082044494 11:47713938-47713960 ACACTTCTGAAGAACAAGGTGGG + Intronic
1083119856 11:60500898-60500920 ACACATCTGAAGCAGGAGGTGGG - Intronic
1085809927 11:79670666-79670688 TCATATCTGGAGCAGGGGGTGGG + Intergenic
1087922413 11:103881648-103881670 TCACATTTGAAACAGGAGTTAGG + Intergenic
1089343839 11:117777732-117777754 AGCCAGCTGAGGCAGGAGGTGGG - Intronic
1090131333 11:124145451-124145473 AAAGATCTGAAGCAGGATGGTGG - Intronic
1090404067 11:126466812-126466834 AGCTTTCTGAAGCAGGAGGTGGG - Intronic
1090453867 11:126830324-126830346 ATACTTATGAAGCAGGAGGATGG - Intronic
1091279553 11:134374239-134374261 ACCTTTCTGAAGCTGGAGGTTGG + Exonic
1091768621 12:3137644-3137666 ACGCAGCTGGAGCAGGGGGTGGG - Intronic
1092244779 12:6857612-6857634 ACACGTCTAGAGCAGGAGGCAGG - Exonic
1092883580 12:12906756-12906778 ACACATCTTAAGGAGGAGGCCGG + Intronic
1092959138 12:13579237-13579259 ACACAGCTGAAGAAGGAAGCAGG + Intronic
1094061886 12:26322988-26323010 TCACAACTGAAGGAGGATGTAGG + Intergenic
1094282218 12:28753026-28753048 AAGCATCTGAAGCAGGTGATAGG + Intergenic
1095407692 12:41885846-41885868 ACTCATCTGAAGCTGTAGATGGG + Intergenic
1096794935 12:54070819-54070841 CCTCATCTGAGGCTGGAGGTGGG + Intergenic
1097059866 12:56274838-56274860 ACACAGCTGCAGAAGGAAGTTGG - Exonic
1098417205 12:70247844-70247866 ACAGATCTGAAGCAACAGATTGG + Intronic
1099803863 12:87492653-87492675 ACACAGCTGAAGCAGGAGGGAGG - Intergenic
1100073640 12:90752640-90752662 ACACATTTGAAGCAGTGTGTAGG - Intergenic
1102533884 12:113566921-113566943 ACAGCCCTGGAGCAGGAGGTGGG + Intergenic
1104276863 12:127337003-127337025 CCACCTCTGCAGCTGGAGGTGGG - Intergenic
1106656464 13:31752243-31752265 AGTCATCTGAAGAAGGAGGGGGG + Intronic
1107332830 13:39320045-39320067 AAACAACTGAAGCAGGATGTGGG + Intergenic
1109215755 13:59587898-59587920 ACCCCTTTGAAGCAGGAGGTAGG - Intergenic
1110579363 13:77101323-77101345 ACACATCTGACACAGGGAGTAGG - Intronic
1110911370 13:80969655-80969677 ACACGTCAGAAGCAGGAAATGGG + Intergenic
1111140421 13:84111329-84111351 ACAAATCTTAAGTATGAGGTTGG + Intergenic
1111674386 13:91368865-91368887 ACACATCTGAAGTGAGTGGTTGG - Intergenic
1111824050 13:93246090-93246112 AAACAGCTCAAGGAGGAGGTTGG - Intronic
1112483422 13:99798144-99798166 ACCTATCTGAAGAAGGAGGGAGG + Intronic
1113469162 13:110532092-110532114 TCACATCTTAAGCATGGGGTGGG + Intronic
1113923807 13:113929369-113929391 CCACATGTGCAGCGGGAGGTGGG - Intergenic
1113987296 13:114328321-114328343 ACACAGCTGGGGCAGGAGGCAGG - Intergenic
1114311444 14:21471318-21471340 AAAAATCTGAAGCAGCAGGCTGG + Intronic
1117015359 14:51512314-51512336 AAAAATCTGAAGCAGGAGCAGGG - Intronic
1119502829 14:75145209-75145231 AGACGTCTGAAGCAGGAAGCAGG + Intronic
1119625388 14:76170016-76170038 ATGCATCTGAAGCAGCAGGAGGG - Intronic
1121244331 14:92451346-92451368 ACTCGACTGAAGCAGGAGGAAGG + Intronic
1122614489 14:103007782-103007804 GCAGATCTGAAGCAGGAAGCAGG + Intronic
1123681265 15:22765822-22765844 GCACAGCTGAAGCATGAGGAGGG + Intergenic
1124333476 15:28840284-28840306 GCACAGCTGAAGCATGAGGAGGG + Intergenic
1124439281 15:29675039-29675061 CCAGAGCTGCAGCAGGAGGTCGG - Intergenic
1127319009 15:57824555-57824577 ACACTTCTGAAGGATAAGGTGGG + Intergenic
1128677676 15:69623837-69623859 ACCCATGTCAGGCAGGAGGTAGG - Intergenic
1128693411 15:69742658-69742680 ACACAGCTGGAGCAGGAGGCTGG + Intergenic
1129530345 15:76260083-76260105 GCCCAGCTGAAGCAGGAGGATGG - Intronic
1129656818 15:77529982-77530004 ACACACCACAAGCATGAGGTGGG + Intergenic
1131829139 15:96343349-96343371 CCTCCTCTCAAGCAGGAGGTTGG - Intergenic
1131838457 15:96413027-96413049 ACTCCTCTAAAGAAGGAGGTTGG + Intergenic
1132347823 15:101119035-101119057 ACTCATATGTAGCTGGAGGTTGG + Intergenic
1133169742 16:3974843-3974865 ACAGATGTGAAGAAAGAGGTGGG - Intronic
1134229336 16:12416879-12416901 TCACCCCTGAAGCTGGAGGTGGG - Intronic
1134527902 16:14958366-14958388 ACATAGCTGGAGCAGGAGGAAGG - Intergenic
1135056608 16:19237354-19237376 ACACTTTTGAGGCAGGAGGTGGG + Intronic
1136502375 16:30678721-30678743 ACACTTCTGAAGTAGGAGTGAGG - Intergenic
1136549123 16:30972942-30972964 GCACATCTGCAGGAGGAGGAAGG + Intronic
1137619799 16:49868661-49868683 CCTTGTCTGAAGCAGGAGGTGGG + Intergenic
1138473856 16:57259126-57259148 ACACACCTGAGGCTGGAGGAGGG + Intronic
1138587736 16:57982069-57982091 AATCAACTGAAGCAGGAGGAAGG - Intronic
1138998858 16:62484493-62484515 TGACATCTGAAGTAGGAGGGGGG - Intergenic
1139216730 16:65132903-65132925 ACACAGGTGAAGCAGGACGCAGG + Intergenic
1140485917 16:75293081-75293103 ACACACCAGAAGCAGGTTGTGGG + Intergenic
1140593018 16:76375632-76375654 ACACTTCTGATGCAGGAGCCTGG - Intronic
1143638927 17:8184210-8184232 ACACATCTGAGTCCAGAGGTGGG + Intergenic
1144855731 17:18266691-18266713 ACACCTATGAACCAGGATGTGGG - Intergenic
1148062855 17:44848565-44848587 AAACAGCTGTACCAGGAGGTGGG + Intronic
1148845465 17:50527387-50527409 CCACATCTGGTGCAGGAGGTTGG - Exonic
1149270260 17:54969207-54969229 CCACAGCTGGAGCAGGAGGGAGG + Intronic
1149575093 17:57706245-57706267 AGACATCAGAAGCAGGAGAAGGG + Intergenic
1150637972 17:66929602-66929624 TCACTTCTGAGGTAGGAGGTGGG - Intergenic
1150706564 17:67492372-67492394 AAACATATGAAGCAGGAGGCAGG + Intronic
1151013115 17:70524843-70524865 ACACAGTTGAGGTAGGAGGTGGG + Intergenic
1152536613 17:80953765-80953787 GCACAGCTGCAGCAGGAGCTGGG + Intronic
1153705514 18:7740932-7740954 ACATAGCTGAAGCAGGGAGTAGG + Intronic
1155277419 18:24201860-24201882 ACAGAGCAGATGCAGGAGGTGGG - Intronic
1155893561 18:31295242-31295264 ACATGTCTGATGGAGGAGGTAGG - Intergenic
1156439561 18:37170593-37170615 GAACATTTGATGCAGGAGGTAGG - Intronic
1156453290 18:37278797-37278819 ACACACTTGAAGCAACAGGTTGG + Intronic
1156570285 18:38244752-38244774 ACACATGGGAAGCAGCAGGCAGG + Intergenic
1156828368 18:41461401-41461423 ACACATGGAAAGCAGCAGGTGGG + Intergenic
1157001998 18:43537967-43537989 TGACAACAGAAGCAGGAGGTTGG + Intergenic
1158776246 18:60583491-60583513 AGAGATCTGAAGCAGGTGGATGG - Intergenic
1158963165 18:62602965-62602987 ACACGTCTCAAGGAGGAGGTGGG + Intergenic
1162823537 19:13237417-13237439 ACACTTTTGAAACAGGAGGGAGG - Intronic
1163104316 19:15114775-15114797 ACACGTCTGAAGCAGGCGTGTGG + Exonic
1163562970 19:18031565-18031587 ACACAGCTGCAGAAGGAAGTTGG + Intergenic
1164044463 19:21524092-21524114 ACACAACTGAAGCAGGTCATTGG - Intronic
1164675876 19:30101117-30101139 ACACAGCAGAAGCAGAAGCTTGG - Intergenic
1166922379 19:46238301-46238323 GAACATCTGATGCAAGAGGTTGG - Intergenic
1167149938 19:47702562-47702584 ACCCAGCTGAAGCAGGCGGCAGG - Exonic
1167488738 19:49779677-49779699 ACGCATGTGAGGCAGGAGGATGG - Intronic
926442016 2:12899499-12899521 CCCTATCTGAAGCAGGAGGATGG - Intergenic
927804144 2:26130546-26130568 AGAAAGCTGAAGCAGGAGGATGG - Intronic
928575209 2:32647731-32647753 AGAAATCTGAGGCAGGAGGATGG + Intronic
928705016 2:33940334-33940356 AGACAGCAGAAGCAGGGGGTGGG - Intergenic
929504827 2:42520395-42520417 GCACAACTGAAGCAGGTGGATGG - Intronic
932324193 2:70845164-70845186 ACACATTTAAAGCAGTATGTAGG + Intergenic
932947848 2:76258262-76258284 ACTCATCTGATGCAGAAGCTGGG - Intergenic
933316285 2:80719456-80719478 ACAAATCTGCAGTAGGAGCTGGG - Intergenic
934602949 2:95672150-95672172 ACACACCTTAGGCAGTAGGTGGG - Intergenic
934759583 2:96846441-96846463 ACAGAGCAGAAGCAGGAGGGTGG - Intronic
934956881 2:98630535-98630557 GCACATCTTAAGCTGGAGGGTGG + Intronic
935326958 2:101946200-101946222 CCATCTCTGAAGCAGGAAGTGGG + Intergenic
936536333 2:113314347-113314369 ACACACCTTAGGCAGAAGGTGGG - Intergenic
937672801 2:124556816-124556838 ACACAGGTGAAGCAGGTGGTGGG + Intronic
937672976 2:124558382-124558404 ACACAGGTAAAGCAGGTGGTGGG + Intronic
939728876 2:145757094-145757116 ACACATCTGGAACAGGGTGTTGG - Intergenic
940978429 2:159973555-159973577 ATACATATGAACCAGGAAGTGGG + Intronic
945844044 2:214921910-214921932 AAACATCTGTACCAGGAGGTAGG + Intergenic
946574969 2:221064784-221064806 ACACCTCTGAAACAGGAGGAGGG + Intergenic
947101187 2:226622773-226622795 AGACATCTGAAGCACCATGTCGG + Intergenic
948784214 2:240342993-240343015 ACACATCTGGAATGGGAGGTGGG + Intergenic
1170162252 20:13325331-13325353 ATACATCTTAAGCACGAGGTTGG - Intergenic
1170485622 20:16813039-16813061 ACCCAGCTGCAGAAGGAGGTAGG - Intergenic
1170640785 20:18150793-18150815 ACACAATTGAAACAAGAGGTGGG - Intronic
1171969459 20:31554729-31554751 ACACCACTGAAGCGGGAGGCGGG - Exonic
1173104953 20:40125073-40125095 TCACATCTGAAGTGGAAGGTTGG + Intergenic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1174636446 20:52004929-52004951 ACACAGCTGAAGCAGATGGCAGG - Intergenic
1174961925 20:55167427-55167449 ACACCACTGAAGCAAAAGGTGGG + Intergenic
1178504727 21:33153266-33153288 ACACATTTAAAGCAGGAAGATGG - Intergenic
1178505543 21:33159814-33159836 ACACATTGCAAGCAGCAGGTGGG + Intergenic
1178635382 21:34297972-34297994 ACAGATAGGAAGCAGGATGTGGG + Intergenic
1179141443 21:38729021-38729043 AAATATCTGAAGCAGGTAGTAGG - Intergenic
1180846732 22:18986979-18987001 ACACATGGGATGCAGGAAGTTGG + Intergenic
1181787686 22:25238745-25238767 CCACATCTGTACCAGGAGATAGG + Intergenic
1181819420 22:25463780-25463802 CCACATCTGTACCAGGAGATAGG + Intergenic
1182093428 22:27611112-27611134 ACACCTCTGAAGCATGACCTTGG + Intergenic
1185099799 22:48832822-48832844 ACACATCTGATGATGGATGTTGG + Intronic
949737262 3:7187908-7187930 AGACAACTGAGGTAGGAGGTGGG - Intronic
953482279 3:43261915-43261937 ACACACCTGAAACTGGAGGGAGG + Intergenic
953969504 3:47336126-47336148 TCACATGTGAAGCAGAGGGTGGG + Intronic
956288939 3:67641492-67641514 ACACATCTGAAATTGTAGGTTGG - Intronic
956637699 3:71382573-71382595 GCACATGTGAAGCAGGAGAGTGG - Intronic
958421630 3:93937944-93937966 ACACAGCTTTAGCAGGAGGGTGG + Intronic
958931634 3:100213819-100213841 CAACAACAGAAGCAGGAGGTTGG + Intergenic
959971821 3:112417914-112417936 ACAAATCTGAGGCAGGAACTAGG + Intergenic
960183990 3:114616455-114616477 ACACTTCTGCAGCAGGATCTGGG + Intronic
960572579 3:119199596-119199618 ACGCATATGCAGCAAGAGGTTGG + Intronic
961018912 3:123487706-123487728 AAACATCTGGAGCACAAGGTAGG + Intergenic
961453990 3:127015356-127015378 AACCATCTGAAACAGGAGGAGGG - Intronic
963931136 3:151005464-151005486 ACCCAGCTGAGGCTGGAGGTTGG - Intergenic
965277566 3:166705011-166705033 ACACATCTACAGCAGAAGCTTGG - Intergenic
966041906 3:175501487-175501509 TCACATTTGGAGCTGGAGGTTGG + Intronic
966073226 3:175905028-175905050 ACACATTTGAAGCAGTGTGTAGG + Intergenic
966269262 3:178085014-178085036 AGAGATCTGCAGCAGGAGGCGGG + Intergenic
967885730 3:194332208-194332230 AGACGGCTGGAGCAGGAGGTGGG + Intergenic
969981148 4:11156489-11156511 ACACATCTTAAGTAGGATGTAGG - Intergenic
970151960 4:13099281-13099303 ACACGGCTGAAGCAGGAGGAAGG + Intergenic
971679850 4:29683525-29683547 ACTGATCAGAAGCAGGAGCTAGG + Intergenic
974207605 4:58726502-58726524 AAAAATCAGAAGCAGGAGGAAGG + Intergenic
974840246 4:67291078-67291100 AAAGATTTTAAGCAGGAGGTGGG + Intergenic
975371602 4:73595278-73595300 AATCACCTGAACCAGGAGGTGGG - Intronic
975909989 4:79256090-79256112 ACCCAACTGAAGTAGGAGGCAGG - Intronic
976206338 4:82626564-82626586 CAACATCAGAAGCAGGAGGAGGG - Intergenic
978895437 4:113881370-113881392 ACCCATCTGAATGAAGAGGTTGG - Intergenic
981790872 4:148535524-148535546 ACACACCTGTAGGAGGTGGTTGG + Intergenic
982231093 4:153208905-153208927 GCACATCTGGAGCAGTGGGTGGG + Intronic
982340877 4:154297327-154297349 AGACATCTGAAGCAATAGGTTGG - Intronic
983319904 4:166183398-166183420 ACCCATCTGAAGGATGAGATCGG - Intergenic
984263349 4:177467798-177467820 ACACATCTGAGACATAAGGTTGG + Intergenic
986392254 5:7297816-7297838 GCACAGCTGAAGCATGAGGAAGG + Intergenic
988563834 5:32304598-32304620 AAACATCTTAAACAGGATGTTGG - Intronic
991449436 5:66736399-66736421 ACACAACTGGAGCTGTAGGTTGG + Intronic
991650585 5:68848390-68848412 ATTCAGCTGAAGCAGGAGCTTGG + Intergenic
994563935 5:101415937-101415959 ATACAGCTGAAGGAGGAGGCTGG - Intergenic
994879197 5:105464525-105464547 ATTCATCTGTAGCAGGAGCTAGG - Intergenic
994992893 5:107019923-107019945 ACACAGCCAAAGCAGGAGGAAGG + Intergenic
995413819 5:111887322-111887344 GCACATATGAAGACGGAGGTTGG + Intronic
997468697 5:134104613-134104635 AAAAAGCTGAAGCAGGAGGTAGG - Intergenic
997603366 5:135155624-135155646 ACAGAGCTGTAGCAAGAGGTTGG - Intronic
1001838406 5:174852394-174852416 ACACATCTGAAGCCTGGGCTGGG + Intergenic
1002853963 6:1021309-1021331 ACACATGTGATGCTGCAGGTAGG - Intergenic
1004226933 6:13794082-13794104 ACACATATAAAGAAGCAGGTAGG - Intronic
1004656028 6:17661648-17661670 AAACCTCTGGAGGAGGAGGTAGG - Exonic
1005452940 6:25991921-25991943 CCACATCTGGAGAGGGAGGTGGG - Intergenic
1007336210 6:41156969-41156991 CCACAACTGGGGCAGGAGGTAGG + Intergenic
1007615426 6:43176892-43176914 CCTCATCTGAATGAGGAGGTAGG - Intronic
1008616404 6:53230666-53230688 TCATAGCTGCAGCAGGAGGTGGG + Intergenic
1009649956 6:66463094-66463116 ATACATCTGAGGTAGGAGGCAGG + Intergenic
1013000027 6:106012687-106012709 ACACATCTGGGGCAGGTGCTGGG - Intergenic
1013532347 6:111031642-111031664 AAAAATTTGAACCAGGAGGTCGG + Intergenic
1013819524 6:114137788-114137810 AGACATCAGAAGCAGGAAATGGG - Intronic
1015772561 6:136783986-136784008 AGACCTCTGAAACAGGAAGTAGG + Intronic
1016417804 6:143851342-143851364 ACATATCTGAAGAAACAGGTAGG + Intronic
1018195744 6:161355083-161355105 CCTCAGCTGAAGCAGTAGGTAGG - Intronic
1018322219 6:162623638-162623660 AGACAAATGAAGCAGGAGATAGG - Intronic
1019255800 7:50008-50030 ACAGAACTGAGGTAGGAGGTGGG + Intergenic
1021255572 7:18388306-18388328 GCACATCTGAAGTAGCTGGTAGG + Intronic
1022352552 7:29579540-29579562 ACCCATCTAAAGTTGGAGGTAGG - Intergenic
1022678367 7:32521876-32521898 CCACAGCTGAAGCAGCAGCTGGG - Intronic
1022911149 7:34900514-34900536 TGACAACAGAAGCAGGAGGTCGG + Intergenic
1026641611 7:72131202-72131224 AGAAATCTGAAGAGGGAGGTGGG + Intronic
1027566952 7:79807055-79807077 ACATGACTGCAGCAGGAGGTGGG - Intergenic
1027998642 7:85461998-85462020 CCAAATCTGAAGTAGGAAGTGGG - Intergenic
1028958785 7:96725159-96725181 ACTCAGCTGAGGCAGGAGGATGG - Intergenic
1031557105 7:123191138-123191160 ACCCATCTGAACCAGGAACTAGG - Intronic
1032682319 7:134197589-134197611 ACACATCTCATGCAGAAGGAAGG - Intronic
1034398411 7:150845632-150845654 ACACAGCTGCAGCTGGAGGGAGG + Intronic
1035361017 7:158314547-158314569 GCACATATGGAGCAGGAGCTGGG + Intronic
1036137224 8:6173495-6173517 GCACCTCTGAGGTAGGAGGTGGG + Intergenic
1036208753 8:6825202-6825224 ATATGTCTGAAGCAGCAGGTGGG + Exonic
1038961524 8:32525368-32525390 TCTCATCTTAAGCATGAGGTAGG + Intronic
1039473534 8:37827694-37827716 CCTCATCTGAAGGAGGAGGCTGG + Intronic
1040343069 8:46453921-46453943 ATACTTTTGATGCAGGAGGTTGG - Intergenic
1041623777 8:60001611-60001633 ACACCTCTCCAGCAGGAGTTTGG + Intergenic
1042501782 8:69516335-69516357 ACATTGCTGAAGCAGGAGGAAGG + Intronic
1043787244 8:84418818-84418840 GAACATCTGATGCAAGAGGTTGG - Intronic
1045449501 8:102307774-102307796 GCACATGTCAAGCAGGATGTTGG - Intronic
1049640590 8:143713405-143713427 CCACATCTGAAGCAGGAGAGAGG + Intronic
1050318394 9:4426318-4426340 AGACCTTTGGAGCAGGAGGTGGG - Intergenic
1050586679 9:7119814-7119836 AAACATCTGAACCAGGAGGGAGG - Intergenic
1052799280 9:32952664-32952686 ACACAGCTGGAGCAGGAGCAGGG + Intergenic
1057171161 9:92964021-92964043 ACCCAGCAGAAGCAGGAGGATGG + Intronic
1058717968 9:107739297-107739319 AAACATTTGAAGGAGGAGGAAGG - Intergenic
1059718129 9:116932544-116932566 CCACATTTGAAGCAGTAGGATGG - Intronic
1062039721 9:134398685-134398707 TTACATCTGGAGCAGGGGGTGGG + Intronic
1186053559 X:5625690-5625712 ACACATCTGCATCTGTAGGTAGG + Intergenic
1186233657 X:7483879-7483901 ACACGGCTAAAGCAGGAGGAAGG - Intergenic
1189738668 X:44096781-44096803 ACACTGCTGAGTCAGGAGGTAGG + Intergenic
1190798641 X:53768766-53768788 TCACATCTGAAGGCGGAGGTGGG - Intergenic
1192533019 X:71905502-71905524 ACATCTATGAACCAGGAGGTGGG + Intergenic
1193061757 X:77214707-77214729 ACACATCTGTAGGAGGTGGCTGG + Intergenic
1194497524 X:94635699-94635721 TCACATCTGATGCAGGAGGTGGG - Intergenic
1195919948 X:109973918-109973940 ACACCTCTCCAGCAGGGGGTTGG + Intergenic
1199574071 X:149296248-149296270 ATACTTCTGAAGCAGGAGATTGG + Intergenic
1199653270 X:149969502-149969524 ACAAAGCTGAAGAAGTAGGTAGG - Intergenic
1201776968 Y:17676374-17676396 ACACTTCTGATCCAGCAGGTTGG - Intergenic
1201824589 Y:18229618-18229640 ACACTTCTGATCCAGCAGGTTGG + Intergenic