ID: 1083121820

View in Genome Browser
Species Human (GRCh38)
Location 11:60520678-60520700
Sequence CTGTGAAAACAGCCAGATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 320}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083121820_1083121827 27 Left 1083121820 11:60520678-60520700 CCCTGATCTGGCTGTTTTCACAG 0: 1
1: 1
2: 1
3: 35
4: 320
Right 1083121827 11:60520728-60520750 CACACGGTGCAAGCTGTCAGAGG 0: 39
1: 327
2: 632
3: 1167
4: 1415
1083121820_1083121824 4 Left 1083121820 11:60520678-60520700 CCCTGATCTGGCTGTTTTCACAG 0: 1
1: 1
2: 1
3: 35
4: 320
Right 1083121824 11:60520705-60520727 GCGTTGTCTGCAGCTTTTCCAGG 0: 2
1: 7
2: 41
3: 103
4: 919
1083121820_1083121825 11 Left 1083121820 11:60520678-60520700 CCCTGATCTGGCTGTTTTCACAG 0: 1
1: 1
2: 1
3: 35
4: 320
Right 1083121825 11:60520712-60520734 CTGCAGCTTTTCCAGGCACACGG 0: 149
1: 240
2: 648
3: 834
4: 1265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083121820 Original CRISPR CTGTGAAAACAGCCAGATCA GGG (reversed) Intronic
900018583 1:171351-171373 CTGTGGAAGCAGCCAGGTGAGGG + Intergenic
900048841 1:529946-529968 CTGTGGAAGCAGCCAGGTGAGGG + Intergenic
900071071 1:771770-771792 CTGTGGAAGCAGCCAGGTGAGGG + Intergenic
900730878 1:4258789-4258811 CTGTGAATGCAGCCAGAAGAGGG + Intergenic
901298395 1:8179028-8179050 CACTGAAATCAGCCAGATCTTGG - Intergenic
905605948 1:39300341-39300363 CTGTGACTACAGGCAGATCGAGG + Exonic
906343661 1:45002209-45002231 CTGACAAACCAGCCAGGTCAGGG - Intergenic
907046979 1:51305422-51305444 CTGGGAAAACTGCCTGATCAAGG - Intronic
907571670 1:55489726-55489748 CTGAGAACACAGCCAGACCTGGG - Intergenic
907845925 1:58206631-58206653 CTCTAAAAACAGCAAGATCTGGG - Intronic
908164591 1:61445926-61445948 CTATGGAAAAAGTCAGATCATGG - Intronic
908533502 1:65055956-65055978 CGGGGAAAACAGGAAGATCAGGG + Intergenic
909058006 1:70845400-70845422 CCGTGAAAAAAGCCAGAAGAGGG + Intergenic
909496842 1:76288348-76288370 GTGTTAAAACATCCATATCAAGG - Intronic
910141457 1:84031470-84031492 CTGTGAAAGCAGCCAGAAGCTGG - Intergenic
912267648 1:108174677-108174699 CTGTGAAAAGAGCCAGAAGGGGG + Intronic
915688750 1:157664814-157664836 CTTTTAAAAAAGCCAGATCCTGG - Intergenic
915847068 1:159277590-159277612 CTGGGAAAACACCTAGATAAAGG + Intergenic
916035913 1:160922323-160922345 CTGTGAAAACAGCCAGGAAGTGG + Intergenic
916286297 1:163109315-163109337 CTGTGAAAGCAGCCAGGACGGGG - Intergenic
916650593 1:166831076-166831098 CTGTGAAAGCAGCCAGATGGGGG + Intergenic
917245599 1:172997228-172997250 CTGTGAAAACAGCCAGGAGCAGG + Intergenic
917689985 1:177458890-177458912 CTGTGAAAAAATGCAGCTCATGG - Intergenic
917753080 1:178071991-178072013 ATATCAAAACAGCCACATCAAGG + Intergenic
918886186 1:190197723-190197745 CTGTGAAATCAGCCAGAAGGAGG - Intronic
919035776 1:192307700-192307722 GTGTAAAACCATCCAGATCAAGG + Intergenic
919262044 1:195208706-195208728 CTGTGAAAGTAGCCAGGACAAGG + Intergenic
919576590 1:199318085-199318107 CTGTAAAACCTGTCAGATCATGG + Intergenic
920548016 1:206834860-206834882 CAGTAAAGACAGCCAGCTCAGGG + Intronic
920645494 1:207800624-207800646 CTGTGCAAAAAGCCTGATCAAGG + Intergenic
920783756 1:209020553-209020575 CAGTGAAAGCAGCCAGAAGAGGG + Intergenic
921480529 1:215659757-215659779 CTGTGAAGACAGACCGATTAGGG - Intronic
922573872 1:226649249-226649271 CAGTGAAAACAGCCAGGACTGGG + Intronic
923152520 1:231246395-231246417 CTGTGAATACAGCATGAACAAGG - Intronic
924348617 1:243094785-243094807 CTGTGGAAGCAGCCAGGTGAGGG + Intergenic
924679944 1:246220978-246221000 CTGAGAGAACAGACAGATGATGG + Intronic
1063757055 10:9024004-9024026 CTGTGAAACCAGCTAGAAAATGG + Intergenic
1070006044 10:72425240-72425262 CTGTGAAACCTCCCAGATAAGGG - Intronic
1072428008 10:95346659-95346681 CCCTAAAAACAGCCAGATCTGGG + Intronic
1075114905 10:119618095-119618117 GTGTCCAAACAGCCAGTTCATGG - Intergenic
1076269334 10:129137087-129137109 CTGTGAAGAAAGCCATTTCACGG + Intergenic
1076323169 10:129598866-129598888 CTGTCAAAACAAGCAGCTCAGGG - Intronic
1076500362 10:130931705-130931727 CTGTGAGAACGGGCAGGTCAGGG - Intergenic
1076975188 11:166547-166569 CTGTGGAAGCAGCCAGGTGAGGG + Intergenic
1077033872 11:484485-484507 CTGTAAACACAGCCAGTGCAGGG + Intronic
1079623920 11:22592602-22592624 CTGTCAGAACACCAAGATCAGGG + Intergenic
1080077913 11:28173993-28174015 CTGTAAACACAGCCAGGTAATGG - Intronic
1080219828 11:29888289-29888311 CAGTGAAAAAAGCCAGAATATGG - Intergenic
1080913408 11:36628772-36628794 GTGTGAAAAATGCCAGATGAGGG - Intronic
1081249644 11:40813982-40814004 CTGTGAAAGCAGCCAGGAGAAGG - Intronic
1082746520 11:56968738-56968760 CAGTGAGGACAGACAGATCAAGG + Intergenic
1082766401 11:57171513-57171535 CTGTGAAGAAAACCAAATCAGGG - Intergenic
1083121820 11:60520678-60520700 CTGTGAAAACAGCCAGATCAGGG - Intronic
1083707094 11:64524268-64524290 GTGTGAAAACAGCCACATCCAGG - Intergenic
1084134022 11:67161255-67161277 CTGTGATGACAGCATGATCATGG + Intronic
1084511654 11:69609247-69609269 CTGCCAAAACAGACAGATCATGG - Intergenic
1084564595 11:69921829-69921851 CTGTGAAGCCAGCGAGAGCATGG - Intergenic
1086144497 11:83536788-83536810 TTGTGAAAACAATCAGGTCAGGG + Intronic
1086597973 11:88597183-88597205 ATGTGAGAAAGGCCAGATCAAGG - Exonic
1086991923 11:93313230-93313252 CTGTGAAGACAGCCAGAAGCGGG - Intergenic
1087389376 11:97514529-97514551 CTGTGTAAACGGCCATAGCATGG - Intergenic
1087877523 11:103375488-103375510 CTGTGAAAGCAGCCAGGAGAGGG + Intronic
1091315987 11:134614409-134614431 CTATGCAGGCAGCCAGATCACGG + Intergenic
1093592971 12:20928457-20928479 CTGTGAATCCATCCAGCTCAAGG + Intergenic
1094780763 12:33789634-33789656 CTGTGAAAGCAGCCAGAACGGGG - Intergenic
1095300781 12:40581641-40581663 CTGTGAAAGCAGCCAGAAGTGGG - Intergenic
1095382865 12:41615872-41615894 CTGTGAAAGCAGCCAGGAGAGGG + Intergenic
1095640837 12:44483329-44483351 CTGTGAAAACAGCCAGGAGGGGG - Intergenic
1097262598 12:57727936-57727958 CTGTGAGAGCAGCAAGGTCAAGG - Exonic
1097526238 12:60739871-60739893 CTGTGAAAGCAGCCAGGACGGGG - Intergenic
1098529000 12:71519355-71519377 CTCTGAAAAAAGCAAAATCAAGG - Intronic
1099565924 12:84246352-84246374 CTGTGAAATCAGCCAGAAGCAGG + Intergenic
1100147707 12:91698178-91698200 CTGTGAAAGCAGCCAGACTATGG - Intergenic
1102245129 12:111351072-111351094 ATGTGACAACAGCCAGATGAGGG + Intergenic
1102788623 12:115624655-115624677 CTGAGAAAAAAGGCAGAACATGG + Intergenic
1104535040 12:129610901-129610923 TTCTGATAACAGACAGATCAAGG + Intronic
1105934464 13:25086316-25086338 CTGTGAAAAAACCCAAAGCATGG + Intergenic
1106496928 13:30286770-30286792 CTGTGAAAGCAGCCAGAAGGTGG + Intronic
1106782977 13:33078396-33078418 CAGAGAAAACAGTCAGCTCAGGG + Intergenic
1106929882 13:34652499-34652521 CCGTGAAAGCAGCCAGAAAAAGG + Intergenic
1106962762 13:35019620-35019642 CTGTGAAATCATCCAGATCTGGG + Intronic
1107708222 13:43127719-43127741 GTGTGAAAACAGCAAGATAAAGG - Intergenic
1108219316 13:48216883-48216905 CTGTGAAAGCAGCCAGGTCGGGG + Intergenic
1109628698 13:65014431-65014453 GAGTGAAGACAGCCAGATTAAGG - Intergenic
1109905243 13:68831287-68831309 CTGTGAAAACAGCCAGGAGTGGG + Intergenic
1110064983 13:71092787-71092809 CTGGGAAACCAGCCAGAAAATGG - Intergenic
1110930523 13:81210391-81210413 CTGTGAATGCAGACAGATAAAGG - Intergenic
1111154984 13:84310063-84310085 CTGTGAAAACAGCCAGGAGGGGG + Intergenic
1111189607 13:84790524-84790546 CTGTGAAAACAGCCAGGGATGGG + Intergenic
1112638725 13:101247327-101247349 CTGTGATATCACCCATATCAAGG + Intronic
1113029339 13:105976435-105976457 CTGTGAAAGCAGCCAGGAGAGGG - Intergenic
1116542302 14:46113100-46113122 CTGTGAAAAAAGCCAGGAGAGGG + Intergenic
1118598066 14:67451419-67451441 CTGTGAAAGCAGCCAGGAGAAGG + Intronic
1119421678 14:74511104-74511126 CTGGGAACCCAGCTAGATCATGG + Intronic
1121457151 14:94045739-94045761 GTGTGACCACATCCAGATCACGG + Exonic
1121499102 14:94419433-94419455 CTGTGAAAGCAGCCAGAAAGAGG + Intergenic
1121970757 14:98353883-98353905 CTATGGAATCAGCCAGATCTGGG + Intergenic
1123155054 14:106216787-106216809 CTCTGTAAACAGCCAGAGCCAGG - Intergenic
1123412446 15:20071996-20072018 CTGGGACATCAGCCAGGTCAGGG + Intergenic
1123521788 15:21079109-21079131 CTGGGACATCAGCCAGGTCAGGG + Intergenic
1123696804 15:22884558-22884580 CTGTGAAAACAGCCAGGAGGGGG - Intronic
1125617297 15:41026260-41026282 CTGTGAAAACAGGCTGGGCACGG + Intronic
1126645308 15:50869597-50869619 CTGTGTAAACTGCCATAGCATGG - Intergenic
1126903234 15:53336349-53336371 CTGTGAAAGCAGACAAATTATGG + Intergenic
1128095220 15:64949135-64949157 CTGTGGAAACAGACAGATGCTGG - Intronic
1128876164 15:71203132-71203154 CTGAGAGAACAGCCAGGTGAAGG + Intronic
1129065540 15:72901020-72901042 CAGAGAAAACATCCAGACCAAGG + Intergenic
1129941205 15:79498043-79498065 CTGTGGAAACAGCAAATTCAAGG - Intergenic
1130107327 15:80938678-80938700 CTTTGAAGACAGACAGATCTAGG - Intronic
1130421983 15:83757016-83757038 CTGTGAAAGCAGCCAGGAGAGGG - Intronic
1131051198 15:89349277-89349299 CTCTGAGGCCAGCCAGATCAGGG - Intergenic
1132403686 15:101529503-101529525 CTGTGAACACAGAAAGATTAAGG - Intergenic
1133152501 16:3846522-3846544 CTGTGAAAACAGCAAAATACTGG + Intronic
1133930055 16:10224600-10224622 ATGTGAAAACAGCTATATTAGGG + Intergenic
1134825636 16:17282017-17282039 CCGGGAAGACAGCCAGATTAAGG - Intronic
1135166754 16:20146013-20146035 CTCAGAAAACATCCAGATGAAGG - Intergenic
1135699459 16:24619170-24619192 CTCAGAAAACAGCCCAATCAAGG - Intergenic
1136363225 16:29795102-29795124 CTGTGAAAGCAGGCAGAGGAAGG + Intronic
1137579693 16:49626477-49626499 CTGGGAAAACTGCCATCTCAAGG + Intronic
1137894779 16:52199528-52199550 CTGTTAAAAAATCCAGTTCAGGG + Intergenic
1139795164 16:69476968-69476990 ATGTGCAACCAGCCAGACCAGGG - Intergenic
1140971801 16:80020521-80020543 CTCTGAAACCAGCCTGATCCTGG - Intergenic
1141553457 16:84821329-84821351 GAGTGGGAACAGCCAGATCAGGG - Intronic
1142445075 16:90131112-90131134 CTGTGGAAGCAGCCAGGTGAGGG - Intergenic
1142462435 17:104354-104376 CTGTGGAAGCAGCCAGGTGAGGG + Intergenic
1144026137 17:11277671-11277693 CTGTGAAAGAAGTCAGTTCAGGG + Intronic
1144428535 17:15169166-15169188 CGGAGAAAACAGCCAGGGCAAGG - Intergenic
1145213835 17:21037091-21037113 CAGTGGATACAGCCAGATGATGG + Intronic
1145251375 17:21298605-21298627 CTGTGCATACAGCCAGGTGACGG + Intronic
1147936665 17:44015249-44015271 CTTTGAATGCAGCCCGATCAGGG + Intronic
1148236338 17:45971729-45971751 CTGTGGAAACAGCTGGAACACGG - Intronic
1149072253 17:52556787-52556809 CTGTGAAAGCAGCCAGGAGAGGG + Intergenic
1149116097 17:53098006-53098028 CTGTGAAAGCAGCCAGGAGAGGG + Intergenic
1151411479 17:73933202-73933224 CTGTCAAAACAATCAGATCTAGG + Intergenic
1153492636 18:5665125-5665147 CTGGGAAAACAGGAAGATAATGG + Intergenic
1153960782 18:10138326-10138348 CTGTGAAAAGAGTAAGAACAGGG + Intergenic
1156651364 18:39230255-39230277 CTGTGTGCACAGCCAGATCCAGG - Intergenic
1158182217 18:54729111-54729133 CTGTGAAAACTGTAACATCAAGG + Intronic
1158834872 18:61320435-61320457 GTGTGAAAAAAGACAGATAAAGG + Intergenic
1160521315 18:79509735-79509757 CTGTGACAACTGTCAGCTCACGG + Intronic
1160652141 19:236730-236752 CTGTGGAAGCAGCCAGGTGAGGG + Intergenic
1161085081 19:2331256-2331278 CTGTGAAAGCATCCACATCAAGG - Intronic
1161250569 19:3277842-3277864 CTGGACAATCAGCCAGATCAAGG - Intronic
1162049697 19:8025448-8025470 CTGTCAACACGGCCACATCAAGG + Intronic
1166566052 19:43766333-43766355 CTTTGAACTCAGACAGATCAGGG - Intergenic
926054527 2:9766648-9766670 ATGTAAAAACACTCAGATCAGGG - Intergenic
926635405 2:15173788-15173810 GTGTGGAACTAGCCAGATCAGGG - Intronic
927340918 2:21982448-21982470 CTGTGAAAACTGCCAGGACGGGG - Intergenic
927574830 2:24192263-24192285 CTGAGAAAACAGCAAGGTCTGGG - Intronic
928568812 2:32582174-32582196 ATGTAAAAACAGCCAGCTCTTGG + Intronic
928821487 2:35366750-35366772 CTGTGAAAACAGCCAGGAGGGGG + Intergenic
929955226 2:46452969-46452991 TTGTGAAAACTTCTAGATCAAGG + Intronic
931127304 2:59292386-59292408 ATGTGAGAACAGGCAGACCAAGG - Intergenic
932037849 2:68265483-68265505 TTGTCAAAACAGTCAAATCATGG + Intergenic
933438860 2:82283808-82283830 CTGTGATAACAGACACAGCACGG + Intergenic
933613138 2:84458409-84458431 CTTTGGAATCAGCCACATCAGGG - Intronic
934868813 2:97840642-97840664 TTGTAATAACAGCCAGAACAGGG + Intronic
936690852 2:114886795-114886817 CTGTGAGTACAGCCAGAGCAAGG - Intronic
937433279 2:121859021-121859043 TTGTGAAAACAGTGAGATCTTGG + Intergenic
937554095 2:123132627-123132649 CTGTGAAAGCAGCCAGGAAAGGG + Intergenic
939241854 2:139571839-139571861 CTCTGAAAACAGGAAGATGAAGG + Intergenic
941073202 2:160977997-160978019 CTGTCAAAACTGCCAGCTGAAGG - Intergenic
944895733 2:204162179-204162201 CTGTAAAAACATCTGGATCAGGG - Intergenic
945357918 2:208860666-208860688 CTGTGAAAGCAGCTGGATTAGGG + Intergenic
947054365 2:226084319-226084341 CTGTGAAATCAGCCAGGTGGGGG - Intergenic
947396743 2:229694468-229694490 CTGTGAAAGCAGACAGAAGAGGG + Intronic
947438120 2:230090908-230090930 CAGTGAAAACAGCCATTTCAGGG + Intergenic
947973486 2:234344276-234344298 CTGTGAAAGCTGTCAGATAAGGG - Intergenic
948145678 2:235706690-235706712 CTGTGGATATAGCCACATCATGG - Intronic
948777915 2:240299424-240299446 CCCTGAAAACACCCAGGTCAGGG + Intergenic
948902226 2:240962590-240962612 CCGTGAAAACAGCCAGAAAGAGG + Intronic
1168911475 20:1451408-1451430 CTTTGAGAACTGCCAGATCTAGG + Intronic
1169216737 20:3798550-3798572 CTGGGAAAGCAGACAGACCATGG + Intronic
1170474568 20:16702016-16702038 CTGTGCAAACAGCCAGATCAAGG + Intergenic
1170776425 20:19378751-19378773 ATGAGAAAACAGACAGATGAAGG - Intronic
1171467528 20:25340899-25340921 ATGTGACCACAGCCACATCAAGG - Intronic
1173446388 20:43122613-43122635 CTTTTAAAACAACCAGATCTTGG - Intronic
1173448594 20:43142399-43142421 CTGTGGAAGCAGCCAGGTCTTGG + Intronic
1174116560 20:48230444-48230466 CTGTGCAAACAGCCTGATGATGG - Intergenic
1174903685 20:54527410-54527432 CTGTGAAAGCAGCGAGCTGAGGG - Intronic
1175306827 20:57981977-57981999 CAGTGAAATCAGCAAGATAAAGG + Intergenic
1177628824 21:23700671-23700693 CTATGAAAGCAGCCAGAACAGGG + Intergenic
1178732379 21:35116785-35116807 CTCTGGAAACAGCCAGTTCTGGG + Intronic
1179728067 21:43351515-43351537 CTCTGAAATCAGCCAGCTCTGGG - Intergenic
1180004381 21:45013315-45013337 CTGTGCAAACAGCCAGCAGAAGG + Intergenic
1180393142 22:12303407-12303429 CTGTGAAAGCAGCCAGAAGGAGG + Intergenic
1182193848 22:28493431-28493453 CTGTGAAAACAGGAAAATAAGGG + Intronic
1183724568 22:39581259-39581281 CTGAGGAAGCAGCCTGATCAAGG + Intronic
1184028437 22:41875853-41875875 CTGTGAAATTAGCCAGGTCCTGG + Intronic
1184628385 22:45755871-45755893 CTGTGAACTGAGCCACATCAGGG + Intronic
1185307288 22:50126959-50126981 CTGTGAAATCAGCCACAGCATGG - Intronic
949552269 3:5121240-5121262 CTGTAAAACCAGCCAGAACTGGG - Intergenic
951470983 3:23055882-23055904 CTCTGAAAACAGACACATCCTGG + Intergenic
953229846 3:41055062-41055084 CTGTGGAAACAGGCAGATTGAGG + Intergenic
954516987 3:51187114-51187136 CTGTGAAAGCAGCCAGGAGAGGG + Intronic
954763624 3:52895741-52895763 CTATGGAAACAGCCAGAGCTAGG + Intronic
955130568 3:56162489-56162511 CTGTGAACCCATCCAGTTCAAGG + Intronic
956134300 3:66083793-66083815 CAGTGAAATCAGGCAGATCTGGG - Intergenic
956486730 3:69730872-69730894 ATGTTAAAACAGCAAGATCCAGG - Intergenic
956731928 3:72204190-72204212 CTGTGGAAACAGCCTGAGCTGGG - Intergenic
957113222 3:75992738-75992760 CTGTGAATGCAGCCAGATGATGG + Intronic
957207639 3:77218165-77218187 CAGTGAAAGCATCCAGAGCAAGG - Intronic
957276835 3:78100857-78100879 CTTAAAACACAGCCAGATCATGG - Intergenic
958127526 3:89376724-89376746 CTGTGAAAACTGGCATCTCAAGG - Intronic
958600387 3:96289218-96289240 CTGTGAAAGCAGCCAGAAGGTGG + Intergenic
958679008 3:97301654-97301676 GTGAGAAAACTGCCAGATTATGG - Intronic
958831814 3:99099047-99099069 CTGTGAAAGCAGCCAGAAAAGGG + Intergenic
961191250 3:124963864-124963886 CTGGGAAAACAGCCACAAAATGG + Intergenic
961765115 3:129204083-129204105 TTTTGAAAACAGTCAGAACAGGG + Intergenic
963256784 3:143152866-143152888 CTTTGAAAACAGGCAGAGAATGG - Intergenic
964483851 3:157167184-157167206 CTGTGAGAATAGACAGAACAGGG - Intergenic
964977323 3:162636681-162636703 CTGTGAAGACAGACAGATCTTGG - Intergenic
965106727 3:164365355-164365377 CTGAGAATACAGCCAGTTCTTGG + Intergenic
965392015 3:168116464-168116486 TTCTGAGAACAGCCATATCAGGG + Intergenic
965586507 3:170323438-170323460 CTGGGAAATCAGACAGATCACGG + Intergenic
966241431 3:177758750-177758772 CTGAGAAAACAGGAAGATGATGG - Intergenic
968365691 3:198183242-198183264 CTGTGGAAGCAGCCAGGTGAGGG - Intergenic
970655874 4:18229523-18229545 CTGTGAAAACAGCCAGCAGTGGG - Intergenic
971049747 4:22848212-22848234 CTGAGAAAAAAAGCAGATCATGG + Intergenic
972872178 4:43313401-43313423 CTGTGAAAGCAGCCAGAAGGGGG + Intergenic
973864854 4:55102230-55102252 CTGTGAAATGAGCCAGGTCATGG + Intronic
974177697 4:58345222-58345244 CTGTGAAAGCAGGCAGAGCAGGG + Intergenic
974569685 4:63628433-63628455 CTGTGAAAGCAGCCAGGTGCAGG + Intergenic
974627392 4:64442533-64442555 CTGTGTAAACTGCCATAGCATGG - Intergenic
975040396 4:69739074-69739096 CTGTGAAAGCAGCCAGGAGAGGG - Intronic
975229677 4:71917412-71917434 CAGTGAAAAGGGCCAGATGATGG + Intergenic
975285063 4:72607413-72607435 CTGTGAAAGCAGCCAGAAGCGGG + Intergenic
976570873 4:86609153-86609175 ATGTGAAGACAGCCAGTTGAGGG - Intronic
976715688 4:88120434-88120456 CTGTGAAATCAGCCACAAAAGGG + Intronic
978083350 4:104621100-104621122 CTGTGAAAGCAGCCAGATGGGGG - Intergenic
978549776 4:109913018-109913040 CAGTGAAGTCAGCCAGAGCAGGG + Exonic
979645216 4:123060149-123060171 CTGTGAAAGCAGCCAGAGGGAGG - Intronic
980407692 4:132374642-132374664 CTTTGAAAAGAGCCATCTCATGG - Intergenic
983657438 4:170097863-170097885 CTGTGAAAGCAGCCAGAAGCGGG - Intergenic
985431775 4:189888122-189888144 CTGTGAAAGCAGCCAGGAGAAGG - Intergenic
985788285 5:1911326-1911348 CTGTCTAAACAGCCTGAGCAGGG - Intergenic
987585048 5:19843708-19843730 CTGTGAAAGCAGCCAGAGCAGGG + Intronic
988050253 5:26019431-26019453 ATGGGAAAACACCCATATCATGG + Intergenic
990181632 5:53167056-53167078 CTTTGAAATCAGTCAGATCTAGG + Intergenic
990365377 5:55065254-55065276 AAGTGAAATAAGCCAGATCAAGG - Intergenic
991183887 5:63785595-63785617 CTGTGAAAGCAGCCAGAAGCAGG + Intergenic
992352749 5:75947838-75947860 CTTTGATAAAAGCAAGATCAAGG - Intergenic
993084375 5:83345573-83345595 CTGTGCAAACAGAGAGATCTGGG - Intronic
993254663 5:85574357-85574379 ATTTAGAAACAGCCAGATCATGG - Intergenic
995433439 5:112108353-112108375 CTCAGAAAACACCTAGATCAGGG - Intergenic
995786422 5:115834952-115834974 CTGTGAAGAAAACCAGAGCAAGG - Intronic
995828580 5:116329204-116329226 CTGTGAAAGCAGCCAGGAGAGGG - Intronic
996493829 5:124130226-124130248 CTTTGGAACCAGCCAAATCAGGG - Intergenic
997086525 5:130806437-130806459 CTGTGAAAACAGCCAGGAGTGGG + Intergenic
998254163 5:140572050-140572072 CTTGGAAATCAGACAGATCAGGG + Intronic
998743095 5:145227413-145227435 ATGTGAAAACAGTCAGCTCTGGG + Intergenic
999200442 5:149812641-149812663 CTGAGAAAGAAGCCAGAGCAGGG - Intronic
999490590 5:152046585-152046607 CTGAGGAAACAGCCAGGGCAAGG - Intergenic
999611459 5:153374609-153374631 CAGTGAAGACAGGCAGATCCAGG - Intergenic
999674124 5:153982058-153982080 CAGTGAAAACAGCCAGCTTCTGG - Intergenic
1001419394 5:171574890-171574912 CTGTGAAGACCCACAGATCAAGG - Intergenic
1001473187 5:172030488-172030510 CTGCAAAATCAGCTAGATCATGG - Intergenic
1002272486 5:178081810-178081832 CTGCGAAAACAACCAAAGCAAGG - Intergenic
1002445561 5:179288056-179288078 CTGGGAAAACTGCCTGATCTGGG - Intronic
1003377821 6:5595432-5595454 CTGGTACCACAGCCAGATCAAGG + Intronic
1003476472 6:6488316-6488338 ATGTGAAAAGAGCAAGGTCAGGG + Intergenic
1004074041 6:12329129-12329151 CTGTGAAAAGGGACAGGTCAGGG - Intergenic
1005918443 6:30375836-30375858 TTGGGAAAACTGCCAGAACATGG - Intergenic
1006016542 6:31085784-31085806 CTCTGAAAACAGCCACATTTTGG - Intergenic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1008681405 6:53876802-53876824 CCGTGAAAGCAGCCAGGTAAGGG - Intronic
1010671444 6:78691479-78691501 CTTTGAAAACAGTCAGAACTGGG - Intergenic
1013151139 6:107447625-107447647 CTGTGAAAGCAGCCAGGAGAGGG - Intronic
1013421880 6:109974568-109974590 CTGTGAGATCAGCCAGAGCAAGG + Intergenic
1014269482 6:119320672-119320694 CTCAGAAAACAGCAACATCATGG + Intronic
1014693906 6:124595353-124595375 CTGTGAAAATGGCCAGATAAGGG - Intronic
1014994919 6:128130797-128130819 CTCTGAAAACAGACACATTAAGG + Intronic
1016219341 6:141647063-141647085 CTGTGAAAGCAGCCAGAAGGGGG + Intergenic
1018050330 6:160003954-160003976 CTGGGGGAACAGCCAGTTCAGGG + Intronic
1020900972 7:14003072-14003094 CTTTGAAAACTGCCAGAACGGGG - Intergenic
1021009090 7:15439812-15439834 GTGTGAAACATGCCAGATCAAGG + Intronic
1021333523 7:19369186-19369208 CTGTGAAAACAGACATAGAATGG - Intergenic
1021573267 7:22085789-22085811 CTGTGAAAACAGCCAGGAAGAGG - Intergenic
1022218428 7:28288592-28288614 CTATAGAAACAGACAGATCAAGG + Intergenic
1023267542 7:38423377-38423399 CTGGGAAATCTGCCAGCTCAAGG + Intronic
1023519770 7:41038657-41038679 CTGTGAATAGAGCCAGCTTATGG - Intergenic
1024684881 7:51734340-51734362 CTGTGAAATCAGCCAGGCCGAGG - Intergenic
1028084271 7:86617175-86617197 CTGTGAAAGCAGCCAGGAGAGGG + Intergenic
1028244841 7:88464478-88464500 CTGTGAAAAAATCCAGCTCAGGG + Intergenic
1029617545 7:101668586-101668608 CAGTGACAACACCCAGATCCAGG + Intergenic
1030061426 7:105624349-105624371 CTCAGAAAACAGCCTGATTAAGG + Intronic
1030722340 7:112884687-112884709 CTGTGAAAGCAGCCAGGAGAGGG - Intronic
1030841529 7:114359540-114359562 CTGTGAAAGCAGCCAGAAGTGGG + Intronic
1030955651 7:115848697-115848719 ATGTGAATACATCCAGATAAAGG - Intergenic
1031016860 7:116584985-116585007 CTGTGAAAAGAGCCAGAACCAGG - Intergenic
1032209921 7:129904229-129904251 CTGTCAAAACAGGGAAATCAGGG - Intronic
1032385148 7:131517454-131517476 CTGTGAAAACATCGAGTTCTGGG - Intronic
1032794235 7:135264642-135264664 CTATCAAAAGGGCCAGATCATGG + Intergenic
1035402716 7:158577680-158577702 CTGATAAAACAGACAGATAAAGG + Intronic
1037979064 8:23237743-23237765 TTGTGAAAACAGCCAGGACAAGG - Intergenic
1039309279 8:36298005-36298027 CTGTGAAAACAGCCGGAGTGGGG + Intergenic
1040000779 8:42574945-42574967 CAGTAAAAAAAGCCAGAGCACGG + Intergenic
1040721402 8:50329169-50329191 CTGTGAAAGCAGCCAGGGGAGGG - Intronic
1041788379 8:61661361-61661383 ATGTGTAAACAGCCAGCACATGG - Intronic
1042020259 8:64365721-64365743 CTCTGGCAACAGGCAGATCATGG + Intergenic
1042631468 8:70821336-70821358 CTGTGAAAGCAGCCAGGACAGGG - Intergenic
1043883139 8:85567882-85567904 CTGTGAGAAGAACCAGAACATGG + Intergenic
1044303977 8:90616877-90616899 CTGTGAAAACAGCCAGGAGGTGG + Intergenic
1044740291 8:95319395-95319417 CTGGTCAAACAGCCAGTTCATGG - Intergenic
1045404262 8:101849603-101849625 CAGTTAACACAGCCAGATGATGG + Intronic
1046485293 8:114879726-114879748 CTGTGTAAACAGACTGTTCAAGG - Intergenic
1046733228 8:117748486-117748508 CTTTGAAATCAGCCAGACCTAGG - Intergenic
1046880153 8:119298928-119298950 CTGTGAAAGCAGCCAGGATAGGG - Intergenic
1048116756 8:131532186-131532208 CTGTGAAAGCAGCCAGGAGAGGG + Intergenic
1052164777 9:25311834-25311856 CTGTGGATAAAGCCTGATCAGGG + Intergenic
1052540080 9:29799768-29799790 CTGGAAACACAGCAAGATCATGG + Intergenic
1053391990 9:37742430-37742452 CTGAGAAAAGAGCCAGAACTAGG + Intronic
1054966908 9:71039172-71039194 CTCTGAAATCAGACAAATCACGG + Intronic
1055595615 9:77862096-77862118 CTGTGAAAGCAGCCAGGAGAGGG - Intronic
1056032127 9:82563967-82563989 CTTTTAAAACAAGCAGATCATGG - Intergenic
1056854152 9:90110713-90110735 TAGTAAAGACAGCCAGATCAAGG - Intergenic
1057762436 9:97887812-97887834 CTGTGAGAACTCCCAAATCAGGG + Intergenic
1058210413 9:102161252-102161274 CTGTGAAAGCAGCCAGGTGTAGG - Intergenic
1059069446 9:111120216-111120238 CTGTGAAAGCAGCCAGGACTGGG - Intergenic
1060504627 9:124188526-124188548 TTGGGAAAACAGCCAGCTCCAGG - Intergenic
1060740590 9:126095429-126095451 CTTTGAAAACAGAAAAATCATGG - Intergenic
1060902943 9:127277047-127277069 CTGTAACAGCAGCAAGATCATGG - Intronic
1062750060 9:138246109-138246131 CTGTGGAAGCAGCCAGGTGAGGG - Intergenic
1185764324 X:2712630-2712652 TTGTGGAAACAGCCATTTCAGGG + Intronic
1186552695 X:10523035-10523057 ATATGAAAACTGCCAGATCAAGG - Intronic
1188055998 X:25541801-25541823 CTGTGAAAGCAGCCAGAAGGGGG - Intergenic
1188127158 X:26383518-26383540 CTGTGAAAGCAGCCAGGAGAGGG + Intergenic
1188393008 X:29644482-29644504 CTGTGAAATCACCCATATCCAGG + Intronic
1190225116 X:48539492-48539514 CTGTCAAAACAACCAAACCACGG + Exonic
1190557921 X:51655564-51655586 CTGTGAAAACACCAAAATAAAGG + Intergenic
1190846148 X:54192431-54192453 CTGTGCAGACAGACAGATCTGGG + Intergenic
1190950669 X:55139988-55140010 CTGTGAAAGCAGCCAGGGCAGGG + Intronic
1191668491 X:63727237-63727259 CAGTGGAATCAGCCAGATCTGGG - Intronic
1191986616 X:66988012-66988034 CTGTGAAAGCAGCCAGGGAATGG - Intergenic
1192190574 X:68988957-68988979 CTGTGCAATCAGACAGATCGTGG - Intergenic
1192232561 X:69276019-69276041 CAGAGGAAACAGCCAGTTCAAGG + Intergenic
1192250120 X:69405771-69405793 CTTTGAAATCAGTCAGATCTGGG - Intergenic
1192332372 X:70186583-70186605 CTGTGGAAAGAGCCAGAAGATGG - Intronic
1192533193 X:71907311-71907333 CTGTGGAAACTGCCAGCTCAAGG + Intergenic
1192626260 X:72731941-72731963 CTGTGAATACCACCAGAGCATGG + Intergenic
1194082913 X:89490238-89490260 ATGTGAAAACTGCCAAATCTTGG + Intergenic
1194182789 X:90734651-90734673 CTGTGAAAGCAGCCAGAAGCAGG + Intergenic
1194219870 X:91176918-91176940 CTGTGAAAGCAGCCAGAAGGGGG + Intergenic
1194365212 X:93006241-93006263 CTGTGAAAGCAGTCAGTACAGGG - Intergenic
1196062719 X:111428353-111428375 TTGTGAAAAAAACCATATCATGG - Intergenic
1196283093 X:113846849-113846871 CTGTGAAAGTAGCCAGATAAAGG + Intergenic
1196500908 X:116380639-116380661 CTCTGAAATAAGACAGATCAGGG + Intergenic
1198453488 X:136792115-136792137 CTGTGAAGACAGACAGATTGTGG - Intergenic
1198660863 X:138966315-138966337 CTGTGAAAGCAGCCAGGGCAGGG + Intronic
1199605302 X:149573449-149573471 CAGTAAACACAGCCAGATGAAGG - Intergenic
1199633819 X:149795919-149795941 CAGTAAACACAGCCAGATGAAGG + Intergenic
1199645393 X:149904752-149904774 CAGTAAACACAGCCAGATGAAGG + Intergenic
1200023711 X:153236113-153236135 CTGTGAAAACATTCAGATATTGG + Intergenic
1200529408 Y:4316606-4316628 CTGTGAAAGCAGCCAGAAGCAGG + Intergenic
1200591297 Y:5079207-5079229 CTGTGAAATCAGCCAGGAGAGGG - Intronic
1200700184 Y:6395494-6395516 GTGTGAGAACAGCCAGTTTAAGG - Intergenic
1200944960 Y:8825620-8825642 CTGGGAAAACATCAAAATCATGG + Intergenic
1201033927 Y:9769204-9769226 GTGTGAGAACAGCCAGTTTAAGG + Intergenic