ID: 1083126239

View in Genome Browser
Species Human (GRCh38)
Location 11:60568780-60568802
Sequence CTACTCCCGCCCTTCACCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083126239_1083126243 13 Left 1083126239 11:60568780-60568802 CCAAGGGTGAAGGGCGGGAGTAG No data
Right 1083126243 11:60568816-60568838 AAAAATAACTAATGAGTATCAGG No data
1083126239_1083126241 -10 Left 1083126239 11:60568780-60568802 CCAAGGGTGAAGGGCGGGAGTAG No data
Right 1083126241 11:60568793-60568815 GCGGGAGTAGAGAGAGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083126239 Original CRISPR CTACTCCCGCCCTTCACCCT TGG (reversed) Intergenic
No off target data available for this crispr