ID: 1083129919

View in Genome Browser
Species Human (GRCh38)
Location 11:60615684-60615706
Sequence CGCGCCTCAGGTGTCCGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083129903_1083129919 28 Left 1083129903 11:60615633-60615655 CCACCCTCGTCTTGGGAGCCTGC No data
Right 1083129919 11:60615684-60615706 CGCGCCTCAGGTGTCCGCGCGGG No data
1083129906_1083129919 24 Left 1083129906 11:60615637-60615659 CCTCGTCTTGGGAGCCTGCAGGC No data
Right 1083129919 11:60615684-60615706 CGCGCCTCAGGTGTCCGCGCGGG No data
1083129912_1083129919 -8 Left 1083129912 11:60615669-60615691 CCATGGGAGCCCCACCGCGCCTC No data
Right 1083129919 11:60615684-60615706 CGCGCCTCAGGTGTCCGCGCGGG No data
1083129904_1083129919 25 Left 1083129904 11:60615636-60615658 CCCTCGTCTTGGGAGCCTGCAGG No data
Right 1083129919 11:60615684-60615706 CGCGCCTCAGGTGTCCGCGCGGG No data
1083129911_1083129919 0 Left 1083129911 11:60615661-60615683 CCGCGGAGCCATGGGAGCCCCAC No data
Right 1083129919 11:60615684-60615706 CGCGCCTCAGGTGTCCGCGCGGG No data
1083129908_1083129919 10 Left 1083129908 11:60615651-60615673 CCTGCAGGCTCCGCGGAGCCATG No data
Right 1083129919 11:60615684-60615706 CGCGCCTCAGGTGTCCGCGCGGG No data
1083129902_1083129919 29 Left 1083129902 11:60615632-60615654 CCCACCCTCGTCTTGGGAGCCTG No data
Right 1083129919 11:60615684-60615706 CGCGCCTCAGGTGTCCGCGCGGG No data
1083129901_1083129919 30 Left 1083129901 11:60615631-60615653 CCCCACCCTCGTCTTGGGAGCCT No data
Right 1083129919 11:60615684-60615706 CGCGCCTCAGGTGTCCGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083129919 Original CRISPR CGCGCCTCAGGTGTCCGCGC GGG Intergenic