ID: 1083132098

View in Genome Browser
Species Human (GRCh38)
Location 11:60634116-60634138
Sequence CTGGATATTCAGATCAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083132098_1083132105 3 Left 1083132098 11:60634116-60634138 CCCTGTCTGATCTGAATATCCAG No data
Right 1083132105 11:60634142-60634164 ACTAGGACAAGGGTGTGACAGGG No data
1083132098_1083132102 -7 Left 1083132098 11:60634116-60634138 CCCTGTCTGATCTGAATATCCAG No data
Right 1083132102 11:60634132-60634154 TATCCAGAGTACTAGGACAAGGG No data
1083132098_1083132107 30 Left 1083132098 11:60634116-60634138 CCCTGTCTGATCTGAATATCCAG No data
Right 1083132107 11:60634169-60634191 TGATCACTTTCCTCCTGGCCTGG No data
1083132098_1083132104 2 Left 1083132098 11:60634116-60634138 CCCTGTCTGATCTGAATATCCAG No data
Right 1083132104 11:60634141-60634163 TACTAGGACAAGGGTGTGACAGG No data
1083132098_1083132106 25 Left 1083132098 11:60634116-60634138 CCCTGTCTGATCTGAATATCCAG No data
Right 1083132106 11:60634164-60634186 GAGTTTGATCACTTTCCTCCTGG No data
1083132098_1083132101 -8 Left 1083132098 11:60634116-60634138 CCCTGTCTGATCTGAATATCCAG No data
Right 1083132101 11:60634131-60634153 ATATCCAGAGTACTAGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083132098 Original CRISPR CTGGATATTCAGATCAGACA GGG (reversed) Intergenic
No off target data available for this crispr