ID: 1083140118

View in Genome Browser
Species Human (GRCh38)
Location 11:60714740-60714762
Sequence CTTTGGGTGTGGAGACCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 236}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083140118_1083140122 -9 Left 1083140118 11:60714740-60714762 CCCTCAGGTCTCCACACCCAAAG 0: 1
1: 1
2: 1
3: 16
4: 236
Right 1083140122 11:60714754-60714776 CACCCAAAGCAACCTATCAAGGG 0: 1
1: 0
2: 0
3: 15
4: 123
1083140118_1083140123 -8 Left 1083140118 11:60714740-60714762 CCCTCAGGTCTCCACACCCAAAG 0: 1
1: 1
2: 1
3: 16
4: 236
Right 1083140123 11:60714755-60714777 ACCCAAAGCAACCTATCAAGGGG 0: 1
1: 0
2: 0
3: 7
4: 111
1083140118_1083140130 26 Left 1083140118 11:60714740-60714762 CCCTCAGGTCTCCACACCCAAAG 0: 1
1: 1
2: 1
3: 16
4: 236
Right 1083140130 11:60714789-60714811 ATGGTCATCTTTTTTCTCAGAGG 0: 1
1: 0
2: 5
3: 25
4: 273
1083140118_1083140121 -10 Left 1083140118 11:60714740-60714762 CCCTCAGGTCTCCACACCCAAAG 0: 1
1: 1
2: 1
3: 16
4: 236
Right 1083140121 11:60714753-60714775 ACACCCAAAGCAACCTATCAAGG 0: 1
1: 0
2: 0
3: 12
4: 103
1083140118_1083140127 7 Left 1083140118 11:60714740-60714762 CCCTCAGGTCTCCACACCCAAAG 0: 1
1: 1
2: 1
3: 16
4: 236
Right 1083140127 11:60714770-60714792 TCAAGGGGCTTCCCTAAACATGG 0: 1
1: 0
2: 0
3: 10
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083140118 Original CRISPR CTTTGGGTGTGGAGACCTGA GGG (reversed) Intronic
900145093 1:1155672-1155694 CTTTGGGAGTGGAGCCCTTTGGG + Intergenic
901032902 1:6318657-6318679 CGTTGACTGTGTAGACCTGAGGG - Intronic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
904265855 1:29318209-29318231 CTTTGGCTGGGGAGACCTCGAGG + Intronic
908805700 1:67929361-67929383 CTGTGTGTGTAGACACCTGAAGG - Intergenic
909083235 1:71140522-71140544 CTTTGGGTGTGTGGCCCTAAGGG - Intergenic
909405295 1:75281886-75281908 CTTTGGAGGTGGAAACCTCATGG + Intronic
912821319 1:112870108-112870130 GTTTGGGTCTAGAGACCTTAAGG - Intergenic
915319280 1:155047402-155047424 CCTTGGGTGTGGAGAGATGGGGG + Intronic
915714570 1:157932228-157932250 CTTTGGGAGTGCAGACTTAAGGG + Intergenic
916202779 1:162287722-162287744 CTTTGAGTTTTGAGTCCTGATGG + Intronic
916231373 1:162544468-162544490 ATTTGGGTATGGACAGCTGAGGG - Intergenic
921193027 1:212726530-212726552 CATTTGCTGTGGAGACCAGAGGG - Intronic
921724145 1:218506004-218506026 CTTTTTTTGTAGAGACCTGAAGG + Intergenic
922432441 1:225569320-225569342 CTTGGGGTGTGGGGAGCTGGGGG + Intronic
922480693 1:225938594-225938616 CTTTGGGAGTGGAGGCCAGCGGG - Intronic
922540312 1:226414275-226414297 CTTTGTGTGTGGGGAGGTGAGGG + Intergenic
923280600 1:232439394-232439416 CTTTGGGTCTGGCGACCTGATGG - Exonic
1063162615 10:3430617-3430639 CTTTGGGTGTCGAGAGCTAGTGG - Intergenic
1063665406 10:8057834-8057856 CTGTGAGTGAGGAGGCCTGAAGG - Intronic
1063907496 10:10796189-10796211 ATTTGGGTGTGGAGAAATTAAGG - Intergenic
1072045855 10:91654148-91654170 CTTTGGGTGTTGAAACGTAATGG - Intergenic
1073231435 10:101974440-101974462 CTGTGGCTTTTGAGACCTGATGG - Intronic
1074769515 10:116724227-116724249 CTTTGGGTTCAGAGACCAGAAGG + Intronic
1075589075 10:123678479-123678501 CTTGGGGTCAGGAGGCCTGAAGG + Intronic
1076102464 10:127794114-127794136 CTGTGGGTTTGCAGACTTGAGGG - Intergenic
1076405513 10:130209915-130209937 CTCTGGGTTTGGACCCCTGATGG - Intergenic
1076501343 10:130938834-130938856 CTTTCGGTGTTGAGCCCTGAAGG - Intergenic
1076560765 10:131361855-131361877 CTTTGGGTATGTCGACCTGGAGG - Intergenic
1076652814 10:132001589-132001611 ACTTGGGTGTGGAGAGATGAGGG - Intergenic
1076772667 10:132675055-132675077 CTTTGGGTATGGAGGACTGAGGG - Intronic
1078108473 11:8373344-8373366 CTGGGGGTGTGGAGCCCTCATGG + Intergenic
1078427802 11:11265694-11265716 CTTTGGCTGTGGGGTCCTGCTGG + Intergenic
1078748589 11:14138841-14138863 GTTTGGGTGTGGAGAGATCAAGG - Intronic
1078779359 11:14422392-14422414 CTTGGGAGGTGGAGACCTGTGGG - Intergenic
1079306710 11:19329799-19329821 ATTTTGGTGGGGAGATCTGAAGG + Intergenic
1080960866 11:37158300-37158322 CTTTCGATGTGTAAACCTGAAGG + Intergenic
1083140118 11:60714740-60714762 CTTTGGGTGTGGAGACCTGAGGG - Intronic
1083709099 11:64536728-64536750 GATTGTGTGGGGAGACCTGAAGG + Intergenic
1091311840 11:134580454-134580476 CTGTGGGTGGGGAGCTCTGAGGG + Intergenic
1091558022 12:1590515-1590537 GTTTGGCTGTGGAGACCTATGGG - Intronic
1091852240 12:3708869-3708891 ATTTAGGTCTGGAGACTTGAAGG - Intronic
1092963826 12:13622440-13622462 CTTTGGGGGTGGGGAAGTGAGGG - Intronic
1095930469 12:47620295-47620317 GGTTGGGGGTGGAGAACTGAGGG - Intergenic
1098689764 12:73472326-73472348 ATCTTGGTGTGGAGAACTGAAGG + Intergenic
1098953936 12:76669308-76669330 TGTTGTGTGAGGAGACCTGATGG + Intergenic
1104980601 12:132571678-132571700 CTTGGGGTGGGGACACCAGAAGG - Intronic
1106312115 13:28563418-28563440 CTGTGGGTGGGAAGACCTGTTGG + Intergenic
1109269336 13:60236870-60236892 CGGTGGGTGTGGAGAACAGATGG - Intergenic
1113591727 13:111506237-111506259 CTTTGCATCTGGAGAGCTGAAGG + Intergenic
1113713709 13:112488730-112488752 TGGTGGGTGTGGAGACCTGGGGG - Intronic
1114988886 14:28263324-28263346 CCTTGGAGGTGGAGAACTGAGGG + Intergenic
1118142962 14:63105045-63105067 CTTTTGGTGTGTAGAACTGAGGG - Intergenic
1121236871 14:92398113-92398135 CTTTTGGTGTGTGGACCTAAAGG - Intronic
1122302552 14:100739210-100739232 CCTTGGGTGGGGAGACCAGAGGG - Intergenic
1124955209 15:34355825-34355847 CCTTGGGTGTGGAGAGGAGAGGG + Exonic
1128475369 15:67992794-67992816 ATTTGGGTGAGGAGGGCTGAAGG - Intergenic
1129082243 15:73051958-73051980 CTCTGGCTGCAGAGACCTGAGGG - Exonic
1129667074 15:77585231-77585253 CTTTGGGTGTACAGGACTGAAGG + Intergenic
1130034111 15:80342105-80342127 ACTCAGGTGTGGAGACCTGAAGG - Intergenic
1130402057 15:83566426-83566448 CTTTGGGCTTGGGGACCTGGAGG + Intronic
1130554491 15:84913290-84913312 CTTGGGGTCTGGAGACATGAGGG + Intronic
1132471217 16:104435-104457 CTATGGGTATGGAGAAATGAGGG + Intronic
1132728611 16:1349713-1349735 GTTTGGGTGTGGAGAGCACAGGG - Intronic
1133580287 16:7138172-7138194 CTTTGGGTGTGAGGATCAGATGG + Intronic
1134237709 16:12480572-12480594 ATTTGGGTGTGGACATCTGTGGG + Intronic
1139138490 16:64233460-64233482 CTTTGGGTTTGGGGGGCTGAAGG + Intergenic
1139285183 16:65806458-65806480 CTTTGGGTGTGGTGCTGTGAAGG - Intergenic
1139515473 16:67450083-67450105 TCCTGGGTGTGAAGACCTGAGGG - Intronic
1140487904 16:75308686-75308708 CTTGGGCTGTTGAGAGCTGATGG - Intronic
1143052577 17:4138147-4138169 CTTGGGTAGTGGAGAGCTGAGGG + Intronic
1143058593 17:4180930-4180952 CTATGGCTGGGGAGACCAGATGG - Intronic
1143315695 17:6031771-6031793 CTTTTGGTGAGGACGCCTGAAGG - Intronic
1144959794 17:19038679-19038701 TCTGGGGTTTGGAGACCTGAAGG + Intronic
1144975366 17:19135845-19135867 TCTGGGGTTTGGAGACCTGAAGG - Intronic
1147002784 17:37376537-37376559 TCTTGGGTGGGGAGAGCTGAGGG + Intronic
1148138904 17:45314380-45314402 CCTGGTGTGTGGAGACCAGAGGG + Intronic
1148718837 17:49736006-49736028 CTCTGGGTGTTGAGAGTTGAGGG - Intronic
1151696354 17:75720102-75720124 CTTGGGGTGTGGAGAGGTCAAGG + Intergenic
1154123054 18:11667017-11667039 CTTTGGGTGGGGACGCATGAGGG - Intergenic
1155533319 18:26789995-26790017 CTTTGTGTGAGGAGGCATGAAGG + Intergenic
1158962925 18:62601413-62601435 CATTGCCGGTGGAGACCTGAAGG - Intergenic
1159022793 18:63156782-63156804 CTTTGGGTGTGGAGTCCCCTTGG - Intronic
1159968784 18:74623370-74623392 CTTTGGGTGTGTGCACATGAGGG + Intronic
1163160554 19:15461542-15461564 CGTTGGGTGTGGGGGCCTCAGGG + Exonic
1165186302 19:34025370-34025392 CTTTGGGTTTGGAGATGGGAGGG - Intergenic
1165495237 19:36148854-36148876 CTGTGGGTATGGACACCTGAGGG + Intronic
925101160 2:1247217-1247239 TTCTGGGTGTGTTGACCTGATGG + Intronic
928337719 2:30412390-30412412 ATCTGGCTGTGGAGACGTGAGGG - Intergenic
929597704 2:43186731-43186753 CTGTGGGAGTGAAGACCTCAAGG + Intergenic
932875849 2:75450955-75450977 CTCTGGGTGTGGTCATCTGAAGG - Intergenic
934477541 2:94603396-94603418 CTTTTCGGGTGGAGAGCTGATGG + Exonic
936254896 2:110903198-110903220 CTTTGGGAGAAGAGACCAGAGGG + Intronic
936732902 2:115405492-115405514 CTGTGGGTCTGGAGTCCAGAGGG + Intronic
937825546 2:126365130-126365152 CCTGGGGTATGGAAACCTGATGG - Intergenic
941363610 2:164582762-164582784 ATTAGGTTATGGAGACCTGAAGG - Intronic
942651732 2:178175934-178175956 CTTTGGCTGAGGAGAACTGAAGG - Intergenic
942930625 2:181488354-181488376 CTTTAGGAGTGGAGTGCTGAGGG - Intronic
944394670 2:199253016-199253038 CTCTGGGCGTGTAGACCTCATGG + Intergenic
944486752 2:200214770-200214792 CTTTGGATGTGGAGCGCTGGAGG - Intergenic
947742787 2:232492502-232492524 CTTAGGATTTGGAGACCAGATGG - Intergenic
947878079 2:233480863-233480885 CTGAGGGTGTGGGAACCTGAAGG + Intronic
1172864541 20:38085691-38085713 CTTTGGGTCTGGAGAGATGAAGG - Intronic
1173552536 20:43942930-43942952 CTTCTGGTGTGGAGACAAGAAGG - Intronic
1173783707 20:45776954-45776976 CTTTGGGTTGGGGGACCAGAGGG + Intronic
1173923346 20:46762233-46762255 CTTTGAGTGTTGAGGCCAGAAGG + Intergenic
1174483109 20:50844972-50844994 GTATGTGTGTGCAGACCTGAAGG + Intronic
1174886506 20:54340853-54340875 CTTTGAGTGTGGAATCTTGAAGG - Intergenic
1176008934 20:62881378-62881400 CTTTGGTGGTGGAGACATCAAGG + Exonic
1180143862 21:45909078-45909100 CCTTGGTCGTGGAGACCTGGTGG - Intronic
1180972860 22:19824681-19824703 CTCTGGGTGTGGGGACCAGCGGG + Intronic
1182356896 22:29726242-29726264 CCTTGGGTGTGGACACCAGTGGG + Intronic
1182434284 22:30320387-30320409 CCCTGGGTGTGGGGACCTCAGGG + Intronic
1183827308 22:40398443-40398465 ATCTGGCTGTGGAGGCCTGAAGG - Intronic
950552490 3:13675224-13675246 CTGGGGATGTGGACACCTGATGG - Intergenic
950678623 3:14569581-14569603 CATTGGGTGAGGAGACCTTGGGG + Intergenic
951182611 3:19676825-19676847 CTTAGGGGGTGGGGACCTGGGGG - Intergenic
954527010 3:51280671-51280693 CTCTGGGTCTGGAGCACTGAGGG + Intronic
954887898 3:53892616-53892638 CTTTCAGCGTGGAGACCTAATGG + Intergenic
956707582 3:72012521-72012543 CTTTGGGAGATGTGACCTGAAGG - Intergenic
957293437 3:78306693-78306715 CTCTATGTGTGGAGGCCTGATGG + Intergenic
960002976 3:112752161-112752183 CTTTGGGGGAGAAGAGCTGAAGG + Intronic
960101279 3:113746007-113746029 CTAAGGGTGCGGAGACCTAAGGG - Exonic
960580413 3:119273477-119273499 CTTTGGGTGGTGAGACATGGGGG + Intergenic
961040046 3:123671816-123671838 CTTTGGTGGGGGAGACCAGATGG + Intronic
961477446 3:127157549-127157571 CTGAGGTTGTGGACACCTGATGG + Intergenic
962888505 3:139650633-139650655 CTTTGGCTGTGGAGACTTTTAGG + Intronic
964553655 3:157912125-157912147 CTCTGAGTGTGGTGACCTGCTGG + Intergenic
968598118 4:1495759-1495781 CTTGGAGTGTGGAGACCCTAGGG + Intergenic
969121476 4:4914547-4914569 CTTTGGGTCTGAAGAGATGAGGG + Intergenic
970805351 4:20024376-20024398 CTGTGGGTGTGGGGACCCCAAGG - Intergenic
972926571 4:44015942-44015964 CTTTGGGTCTGGAGACAGGCTGG - Intergenic
974624393 4:64403290-64403312 CTTTGGCTGTGAAGAACTCAGGG - Intronic
976534384 4:86193876-86193898 CTTGCGGTGTAGACACCTGAGGG + Intronic
976715651 4:88120227-88120249 CTTTAGGGGTGGAGCCCTCATGG + Intronic
979763531 4:124436576-124436598 CTATGGCTGTGGACACCTGCAGG + Intergenic
982126137 4:152185517-152185539 TTTGGGGTGGGGAGAGCTGAGGG - Intergenic
984270578 4:177543911-177543933 CATTGGTTGAGGAGACCTGATGG + Intergenic
987924126 5:24318091-24318113 CTTGTGGTGTAGATACCTGAGGG + Intergenic
987998549 5:25317467-25317489 CTATGGCTGTGGGGACTTGAAGG + Intergenic
988831963 5:34996628-34996650 AATAGGGTCTGGAGACCTGAAGG - Intergenic
991008283 5:61854034-61854056 CTGGGTGTGTGGAGGCCTGAGGG - Intergenic
992679383 5:79138903-79138925 CCTTGGGTGTGGAGAGCTCTGGG - Intronic
997850649 5:137329812-137329834 ATTTAGGTGAGGAGACCTGTGGG - Intronic
1001028187 5:168242008-168242030 CTTTGGGGCTGGAGACCTCCAGG - Intronic
1001996536 5:176164921-176164943 CTTTGGAGGTGGAGGCATGAGGG - Intergenic
1003647281 6:7924128-7924150 CTTTGTGTGTGGAGTTCTCAGGG - Intronic
1004231096 6:13834037-13834059 GTTTGGGTCTGGGGACTTGAGGG + Intergenic
1004709568 6:18156212-18156234 CTCTGGGATTGGAGACCTGGAGG + Intronic
1006425900 6:33962877-33962899 CCCTGGGTGTGGCAACCTGAGGG - Intergenic
1007704029 6:43780411-43780433 CTGTGAGTGTGGAGACCTTTGGG + Intronic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1010041079 6:71384360-71384382 CTTTTGGTGGGAAAACCTGAAGG + Intergenic
1012395129 6:98787667-98787689 CTTTGTATGTGGACATCTGAAGG + Intergenic
1013637204 6:112040284-112040306 CTTGGGGTGTGTTGAGCTGAGGG - Intergenic
1014861245 6:126470457-126470479 CTTCAGGGGTGGAGCCCTGATGG + Intergenic
1015366157 6:132400801-132400823 CTTTGGCTTTGGGGACCTAATGG - Intronic
1015689990 6:135911241-135911263 CTGTGGGTGTGGAGATTTAATGG - Intronic
1017661916 6:156683351-156683373 CTTTGAGTGTGGAGAGAAGAGGG - Intergenic
1018740822 6:166727482-166727504 CTTAGGGTGCTGATACCTGAGGG - Intronic
1019299984 7:298018-298040 CTTTCGGTGGGGAGAGCTGGGGG - Intergenic
1019431372 7:1001339-1001361 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431379 7:1001355-1001377 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431389 7:1001389-1001411 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431409 7:1001457-1001479 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431427 7:1001527-1001549 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431438 7:1001561-1001583 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431492 7:1001729-1001751 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431506 7:1001781-1001803 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431515 7:1001813-1001835 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431522 7:1001829-1001851 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431532 7:1001863-1001885 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431542 7:1001897-1001919 CTGTGGGTGGGGAGTCCTGCGGG + Intronic
1019431568 7:1001981-1002003 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431578 7:1002015-1002037 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431627 7:1002185-1002207 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431654 7:1002291-1002313 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431663 7:1002323-1002345 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431670 7:1002339-1002361 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431680 7:1002373-1002395 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431696 7:1002423-1002445 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431710 7:1002475-1002497 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431720 7:1002509-1002531 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431755 7:1002631-1002653 CTGTGGGTGGGGAGTCCTGCGGG + Intronic
1019431783 7:1002737-1002759 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431803 7:1002804-1002826 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431831 7:1002905-1002927 CTGTGGGTTTGGAGTCCTGTGGG + Intronic
1019431854 7:1002991-1003013 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431888 7:1003111-1003133 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431898 7:1003145-1003167 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431922 7:1003231-1003253 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431948 7:1003337-1003359 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431954 7:1003353-1003375 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431968 7:1003405-1003427 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431992 7:1003491-1003513 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432012 7:1003558-1003580 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432018 7:1003574-1003596 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432047 7:1003676-1003698 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432079 7:1003795-1003817 CTGTGGGTTTGGAGTCCTGTGGG + Intronic
1019432085 7:1003811-1003833 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432097 7:1003863-1003885 CTGTGGGTTTGGAGTCCTGTGGG + Intronic
1019432103 7:1003879-1003901 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432117 7:1003931-1003953 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432131 7:1003983-1004005 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019844127 7:3479988-3480010 CTTTGGGCGTGGACAGGTGAGGG - Intronic
1027230349 7:76268404-76268426 CTTGGGGTGGGGAGACCTGCAGG + Intronic
1028474556 7:91239245-91239267 CTTTGGGTGTTGGCTCCTGAAGG + Intergenic
1028541822 7:91950647-91950669 TTTTGTGTGTGGAGACCTTGTGG + Intronic
1032859236 7:135861851-135861873 CTTTGTGTGTGGAGACCTGAAGG + Intergenic
1033137305 7:138796207-138796229 CTCTCGGTGTGGGGACCTGGGGG - Intronic
1033148927 7:138896317-138896339 CTTTGGGTTTAGACACCTAAGGG + Intronic
1033419077 7:141189872-141189894 CTGTGCGTGTGGAACCCTGAAGG + Intronic
1034302109 7:150025281-150025303 TTTTGAGTGTGGACACCAGAGGG - Intergenic
1034803946 7:154072034-154072056 TTTTGAGTGTGGACACCAGAGGG + Intronic
1038325803 8:26571868-26571890 CTTTGTGTGTGTAGCTCTGAAGG - Intronic
1038490178 8:27965156-27965178 CCCTGAGTGTGGAAACCTGAAGG + Intronic
1040475473 8:47773234-47773256 GTTTGGGTGTGGAGGACTGGCGG + Exonic
1041256505 8:55983593-55983615 CTTTGGATGTAGTGTCCTGAGGG - Intronic
1041570058 8:59327752-59327774 TTTTGGGTGTGGAGAAATCATGG - Intergenic
1041786236 8:61637516-61637538 TTTTGGTGGTGGAGAACTGAAGG - Intronic
1042111492 8:65386001-65386023 GTTGGGGTGTGGAGGCCTGGGGG + Intergenic
1042211264 8:66382865-66382887 CTGTGGGTGTGAACTCCTGATGG - Intergenic
1045561833 8:103271534-103271556 CTGTGGGGGTGGAGCCCTCATGG + Intergenic
1045718629 8:105078968-105078990 ATTTGAGAGTGGAGAGCTGAAGG + Intronic
1047637485 8:126780281-126780303 TTTTGGATTTGCAGACCTGAGGG - Intergenic
1048434451 8:134403045-134403067 ATGTGGGTGTGGATACCAGAAGG - Intergenic
1049758381 8:144320818-144320840 CTGTGGGTATGGAGCCCTGCAGG - Intronic
1049807194 8:144546437-144546459 CCTTGGGTGGGGAGACCTCGAGG - Intronic
1050695818 9:8278074-8278096 GTTTGGGGGTGGATTCCTGATGG + Intergenic
1052105558 9:24510397-24510419 CTGTGGGGGTGGAGCCCTCATGG + Intergenic
1053680527 9:40482711-40482733 CTTTTCGGGTGGAGAGCTGATGG - Intergenic
1053930516 9:43111022-43111044 CTTTTCGGGTGGAGAGCTGATGG - Intergenic
1054283185 9:63142224-63142246 CTTTTCGGGTGGAGAGCTGATGG + Intergenic
1054293612 9:63318226-63318248 CTTTTCGGGTGGAGAGCTGATGG - Intergenic
1054391633 9:64622715-64622737 CTTTTCGGGTGGAGAGCTGATGG - Intergenic
1054504094 9:65893613-65893635 CTTTTCGGGTGGAGAGCTGATGG + Exonic
1055371566 9:75605099-75605121 CTTTGGGGTTTGAGACCAGATGG + Intergenic
1058932984 9:109740417-109740439 CATTTTGTGTAGAGACCTGATGG + Intronic
1059378750 9:113907226-113907248 CTTAGGTTGTGGGGACCTGAAGG + Intronic
1060089405 9:120729985-120730007 CTTTGGATGAGTAGACCTGTTGG + Intergenic
1061022835 9:128027306-128027328 CTCTGGGTGTTTAGAACTGAGGG + Intergenic
1061387947 9:130301485-130301507 CTCTGGGTTTGGAGAGATGAGGG + Intronic
1187124704 X:16444409-16444431 CTTAGGCTGTGGAGTCCTGAAGG + Intergenic
1187701032 X:21964489-21964511 CTTTGGGGGTGAACACCTGTTGG + Intronic
1189122324 X:38407937-38407959 CTCTGGGTGAGGAGACATCATGG - Intronic
1189421283 X:40860502-40860524 CTTTTGGTGGGGGGAACTGATGG - Intergenic
1189462462 X:41253526-41253548 CTTTGGGTCTGGGCACCTAAGGG - Intergenic
1190245085 X:48685663-48685685 CTTGGGGTGTGGAGAGGAGATGG + Intronic
1191755049 X:64583742-64583764 CTTTGGGGATGGATACCTGCTGG + Intergenic
1193979459 X:88163721-88163743 CTTTCAGTGTGCACACCTGATGG + Intergenic
1196815130 X:119659424-119659446 CTTTGGGTTTGGTGATATGAAGG - Intronic
1198141804 X:133811777-133811799 AATTGTCTGTGGAGACCTGAGGG - Intronic
1199417660 X:147604581-147604603 CTTTGAGTGTTTTGACCTGAAGG + Intergenic
1200088521 X:153623628-153623650 CTCTGGCTCTGGAGAGCTGAGGG - Intergenic
1200879055 Y:8193463-8193485 CTTTGAGGGTGGAGCCATGATGG + Intergenic