ID: 1083140360

View in Genome Browser
Species Human (GRCh38)
Location 11:60716455-60716477
Sequence TGTTATGTATGATAACCAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083140357_1083140360 19 Left 1083140357 11:60716413-60716435 CCATTTAGATGTCGCTTCCTGAA No data
Right 1083140360 11:60716455-60716477 TGTTATGTATGATAACCAATGGG No data
1083140355_1083140360 30 Left 1083140355 11:60716402-60716424 CCTTTAATGGCCCATTTAGATGT No data
Right 1083140360 11:60716455-60716477 TGTTATGTATGATAACCAATGGG No data
1083140358_1083140360 2 Left 1083140358 11:60716430-60716452 CCTGAAACACGCAAAATTTAAAC No data
Right 1083140360 11:60716455-60716477 TGTTATGTATGATAACCAATGGG No data
1083140356_1083140360 20 Left 1083140356 11:60716412-60716434 CCCATTTAGATGTCGCTTCCTGA No data
Right 1083140360 11:60716455-60716477 TGTTATGTATGATAACCAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083140360 Original CRISPR TGTTATGTATGATAACCAAT GGG Intergenic
No off target data available for this crispr