ID: 1083141535

View in Genome Browser
Species Human (GRCh38)
Location 11:60725849-60725871
Sequence GGGAACTGCCTTATATCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083141530_1083141535 11 Left 1083141530 11:60725815-60725837 CCGAGAAATGGTCATAACAATAA No data
Right 1083141535 11:60725849-60725871 GGGAACTGCCTTATATCTACAGG No data
1083141529_1083141535 12 Left 1083141529 11:60725814-60725836 CCCGAGAAATGGTCATAACAATA No data
Right 1083141535 11:60725849-60725871 GGGAACTGCCTTATATCTACAGG No data
1083141527_1083141535 26 Left 1083141527 11:60725800-60725822 CCTCAGAGAGTTTGCCCGAGAAA No data
Right 1083141535 11:60725849-60725871 GGGAACTGCCTTATATCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083141535 Original CRISPR GGGAACTGCCTTATATCTAC AGG Intergenic
No off target data available for this crispr