ID: 1083144227

View in Genome Browser
Species Human (GRCh38)
Location 11:60746705-60746727
Sequence CTGTAGGCCCAGACTAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083144227_1083144232 20 Left 1083144227 11:60746705-60746727 CCTTGCTTAGTCTGGGCCTACAG No data
Right 1083144232 11:60746748-60746770 ATCAGGCCACCATAAAGAAACGG No data
1083144227_1083144231 3 Left 1083144227 11:60746705-60746727 CCTTGCTTAGTCTGGGCCTACAG No data
Right 1083144231 11:60746731-60746753 TGCTGATACGAGCAATGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083144227 Original CRISPR CTGTAGGCCCAGACTAAGCA AGG (reversed) Intergenic
No off target data available for this crispr