ID: 1083144781

View in Genome Browser
Species Human (GRCh38)
Location 11:60750117-60750139
Sequence TAGCTGGCTGGCTGGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083144781_1083144797 23 Left 1083144781 11:60750117-60750139 CCTCCTCCCCAGCCAGCCAGCTA No data
Right 1083144797 11:60750163-60750185 GGCTGAATAATGGGGAAAGAGGG No data
1083144781_1083144789 2 Left 1083144781 11:60750117-60750139 CCTCCTCCCCAGCCAGCCAGCTA No data
Right 1083144789 11:60750142-60750164 TGTGGCTTCTGCCCTCTCCAAGG No data
1083144781_1083144796 22 Left 1083144781 11:60750117-60750139 CCTCCTCCCCAGCCAGCCAGCTA No data
Right 1083144796 11:60750162-60750184 AGGCTGAATAATGGGGAAAGAGG No data
1083144781_1083144799 29 Left 1083144781 11:60750117-60750139 CCTCCTCCCCAGCCAGCCAGCTA No data
Right 1083144799 11:60750169-60750191 ATAATGGGGAAAGAGGGGAACGG No data
1083144781_1083144798 24 Left 1083144781 11:60750117-60750139 CCTCCTCCCCAGCCAGCCAGCTA No data
Right 1083144798 11:60750164-60750186 GCTGAATAATGGGGAAAGAGGGG No data
1083144781_1083144794 15 Left 1083144781 11:60750117-60750139 CCTCCTCCCCAGCCAGCCAGCTA No data
Right 1083144794 11:60750155-60750177 CTCTCCAAGGCTGAATAATGGGG No data
1083144781_1083144793 14 Left 1083144781 11:60750117-60750139 CCTCCTCCCCAGCCAGCCAGCTA No data
Right 1083144793 11:60750154-60750176 CCTCTCCAAGGCTGAATAATGGG No data
1083144781_1083144800 30 Left 1083144781 11:60750117-60750139 CCTCCTCCCCAGCCAGCCAGCTA No data
Right 1083144800 11:60750170-60750192 TAATGGGGAAAGAGGGGAACGGG No data
1083144781_1083144791 13 Left 1083144781 11:60750117-60750139 CCTCCTCCCCAGCCAGCCAGCTA No data
Right 1083144791 11:60750153-60750175 CCCTCTCCAAGGCTGAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083144781 Original CRISPR TAGCTGGCTGGCTGGGGAGG AGG (reversed) Intergenic
No off target data available for this crispr