ID: 1083145653

View in Genome Browser
Species Human (GRCh38)
Location 11:60756549-60756571
Sequence CAGCCACACCTAAAGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083145643_1083145653 25 Left 1083145643 11:60756501-60756523 CCTGACACCTGGGTAATGGGTGT No data
Right 1083145653 11:60756549-60756571 CAGCCACACCTAAAGTGTTGGGG No data
1083145647_1083145653 -4 Left 1083145647 11:60756530-60756552 CCAAAGTGTTTGCCCAGGCCAGC No data
Right 1083145653 11:60756549-60756571 CAGCCACACCTAAAGTGTTGGGG No data
1083145644_1083145653 18 Left 1083145644 11:60756508-60756530 CCTGGGTAATGGGTGTTTTTTCC No data
Right 1083145653 11:60756549-60756571 CAGCCACACCTAAAGTGTTGGGG No data
1083145646_1083145653 -3 Left 1083145646 11:60756529-60756551 CCCAAAGTGTTTGCCCAGGCCAG No data
Right 1083145653 11:60756549-60756571 CAGCCACACCTAAAGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083145653 Original CRISPR CAGCCACACCTAAAGTGTTG GGG Intergenic
No off target data available for this crispr