ID: 1083147357

View in Genome Browser
Species Human (GRCh38)
Location 11:60769287-60769309
Sequence TGGGGACCCCTGAAAGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083147350_1083147357 30 Left 1083147350 11:60769234-60769256 CCTGTGAGCTCCAACATTTAATC 0: 1
1: 0
2: 0
3: 3
4: 103
Right 1083147357 11:60769287-60769309 TGGGGACCCCTGAAAGTACAGGG 0: 1
1: 0
2: 2
3: 9
4: 136
1083147351_1083147357 20 Left 1083147351 11:60769244-60769266 CCAACATTTAATCATTGTGTTGG 0: 1
1: 0
2: 1
3: 14
4: 191
Right 1083147357 11:60769287-60769309 TGGGGACCCCTGAAAGTACAGGG 0: 1
1: 0
2: 2
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083147357 Original CRISPR TGGGGACCCCTGAAAGTACA GGG Intronic
900009388 1:91958-91980 TGGGGACCTCAGTAAGTAAAGGG - Intergenic
900025499 1:268534-268556 TGGGGACCTCAGTAAGTAAAGGG - Intergenic
900029105 1:357916-357938 TGGGGACCTCAGTAAGTAAAGGG - Intergenic
901629908 1:10642992-10643014 TGGGGGGCCCTGAAAGGACACGG + Exonic
902146527 1:14405742-14405764 TGGAGACCCCAGAAAGCCCATGG + Intergenic
902477762 1:16697177-16697199 TGGAGACCCCTGGGAGTTCATGG + Intergenic
903181921 1:21609103-21609125 TGGGGCCCCTTGAAGGTACCTGG - Intronic
905341678 1:37282419-37282441 TGGGGAGGCTGGAAAGTACATGG + Intergenic
907725554 1:57017140-57017162 TGGGGACCCCTGGAAGCACATGG - Intronic
907803436 1:57794418-57794440 TAGAGACCTCTGAAAGAACATGG - Intronic
909221609 1:72969355-72969377 TGGGGACCCCTGCAAGTTTAAGG + Intergenic
909424656 1:75509009-75509031 TGGGAACCAGTGAAAGTACATGG + Intronic
914419175 1:147513118-147513140 TGGGCAACCCTTAAAGTAAAGGG + Intergenic
916281382 1:163054964-163054986 TGGGGAAGCCTGATAGCACAAGG - Intergenic
919809328 1:201399089-201399111 TCGGGACCCCTGAGGTTACAGGG - Intronic
1063867916 10:10386945-10386967 TGGGAGTCCCTGAAAGTTCATGG + Intergenic
1064187566 10:13175609-13175631 TGGGGACCCCAGGAAGTTCTGGG + Exonic
1064408192 10:15083123-15083145 CGGGGACCCCTGAAATGGCATGG - Intronic
1066099260 10:32103199-32103221 TGGGGACCACTGGATGGACAAGG + Intergenic
1066504189 10:36024830-36024852 TGGTGCACCCTGAAAGTGCATGG - Intergenic
1066517700 10:36182376-36182398 TGGGTGTCCCTGAAAGTATATGG + Intergenic
1067718217 10:48705649-48705671 TGCGGACCCCTGAAATTGCGTGG - Intronic
1072939536 10:99747859-99747881 TGGGATCCCCTGAATATACATGG - Intronic
1073077819 10:100835764-100835786 AGGGGACCCCTGAGGGTGCAGGG + Intergenic
1074758577 10:116646847-116646869 TGGGCACCCCAGAGAGTAAATGG + Intergenic
1076691924 10:132228181-132228203 TGGGGACACCTGGAAATGCATGG + Intronic
1077128583 11:957235-957257 TGGGGATCCCTGGAGGGACATGG - Intronic
1077990412 11:7405028-7405050 TGGGTACCCTGGAAAGCACAAGG - Intronic
1082128163 11:48456256-48456278 TTTGGCCCCCTGAAAGTACCCGG - Intergenic
1083147357 11:60769287-60769309 TGGGGACCCCTGAAAGTACAGGG + Intronic
1086503668 11:87479605-87479627 TGGAAACCCCTGAATGTCCAGGG + Intergenic
1087736630 11:101841496-101841518 TGGGGGCCTCTGAAACTGCATGG - Intronic
1089758643 11:120706600-120706622 AGGGGACCCCTTAAAGGACTGGG + Intronic
1093575866 12:20729399-20729421 TGGAAACCACTGAAAGAACATGG + Intronic
1096533616 12:52257186-52257208 TGGGGACTGCTGATATTACATGG + Intronic
1100839488 12:98597855-98597877 GGTGGACCCCCAAAAGTACAAGG + Exonic
1101451945 12:104787757-104787779 TAGGTGCCCCTGAAAGTAAAGGG - Intergenic
1102210690 12:111124796-111124818 TGGGGACCCCTGGAAGGGGAAGG - Intronic
1105621101 13:22067052-22067074 TGTGTACCCATGAAAGTAGAGGG - Intergenic
1106538010 13:30664930-30664952 TGTGGTGCCCTGAAAATACAAGG + Intergenic
1106760965 13:32867107-32867129 ATGGGAACCCTAAAAGTACACGG - Intergenic
1112026613 13:95417315-95417337 TGGGGATCCCTGAAAGTAGTTGG - Intergenic
1113438891 13:110313330-110313352 TGGTTACCCCTGAAAGGAGAAGG + Intronic
1118393914 14:65319419-65319441 TGGGTAGCCAAGAAAGTACATGG - Intergenic
1126325612 15:47473718-47473740 TGGGGTCCCCTGGAAGGAAAAGG + Intronic
1126341526 15:47645955-47645977 TGGGGCTCCCTGAGAGGACACGG - Intronic
1131002934 15:88952858-88952880 TGGGGACCACTGATAAAACATGG - Intergenic
1134070015 16:11255216-11255238 TGGGGGCCCCTGAGCGTGCACGG - Exonic
1134403248 16:13931954-13931976 TGGGGGCCCCTGGGAGTTCACGG + Intronic
1134503166 16:14784859-14784881 TAGGGACCCTTGAAAGAACTGGG + Intronic
1134577399 16:15344039-15344061 TAGGGACCCTTGAAAGAACTGGG - Intergenic
1134725047 16:16412470-16412492 TAGGGACCCTTGAAAGAACTGGG + Intergenic
1134942385 16:18299388-18299410 TAGGGACCCTTGAAAGAACTGGG - Intergenic
1135107600 16:19664005-19664027 TGTGGACCACTGAAAGAACACGG - Intronic
1135559848 16:23467933-23467955 TGGAGTCCTCTGAAAGGACAAGG - Intronic
1139386777 16:66578171-66578193 TGGGAACCCCTGGCAGTAGAAGG - Intronic
1140255979 16:73336809-73336831 TGATGACCCTTGAGAGTACAGGG - Intergenic
1142454940 16:90214942-90214964 TGGGGACCTCAGTAAGTAAAGGG + Intergenic
1142969449 17:3601334-3601356 TGGGGACCCCTGAGAGGCAAGGG - Intergenic
1143765428 17:9134654-9134676 TTGGAACCCCTGAAAGCTCAGGG - Intronic
1146474670 17:33153266-33153288 TGGTCACCCCAGAAAGGACAGGG - Intronic
1152091934 17:78251994-78252016 TGGGGAGCCCTGGAAGGAGATGG - Intergenic
1152318491 17:79594799-79594821 GGGGCACCCCTGAACATACAAGG + Intergenic
1152707055 17:81849608-81849630 TGGGGACCCCTAATAATGCACGG + Intronic
1152950654 17:83228640-83228662 TGGGGACCTCAGTAAGTAAAGGG + Intergenic
1153478033 18:5518167-5518189 TGTGGACCCTTGAAAGGCCATGG - Intronic
1156212525 18:34961019-34961041 TGGGGATGCCAGGAAGTACAGGG - Intergenic
1156609539 18:38710147-38710169 AGGGGATCCCTGGAACTACAAGG - Intergenic
1158763653 18:60421763-60421785 TGGGGGGCCCTGAAAGGAAATGG + Intergenic
1158797449 18:60864664-60864686 TTGTGACCTCTGTAAGTACAAGG - Intergenic
1160076088 18:75679227-75679249 TGGGGTCACCTGAAGGAACAGGG - Intergenic
1161421676 19:4179278-4179300 TGGGGACCCCTGAAGGTGGCAGG + Exonic
1162141652 19:8589108-8589130 TGGGGACTCCTGACACTCCACGG + Intronic
1162352410 19:10158609-10158631 TGGGGATGCCTGAGAGCACAGGG + Intronic
1163193691 19:15698299-15698321 TGCGGGCACCTGAAAGTGCAAGG + Intergenic
1164329598 19:24241254-24241276 TGGGAGCCCATTAAAGTACATGG - Intergenic
1165829287 19:38722555-38722577 TGGGGAACCCTCAAAGCACCCGG - Intronic
1166774566 19:45304543-45304565 TGGGGAACCATGGAAGTTCAGGG + Intronic
1168126390 19:54285823-54285845 TGGGGACACGTGAAAGTGCCAGG - Intergenic
1168152123 19:54454893-54454915 TGGGGACCCCTGGATGTGCCGGG + Intronic
1168175505 19:54625041-54625063 TGGGGACACGTGAAAGTGCCAGG + Intronic
1202711779 1_KI270714v1_random:23003-23025 TGGAGACCCCTGGGAGTTCATGG + Intergenic
927865187 2:26583523-26583545 TGGGGACCCTGGAAAGGACTTGG + Intronic
930708859 2:54531014-54531036 TGGGGTGCCCTGAGAGGACATGG + Intronic
931126976 2:59289107-59289129 AAGGGACACCTGAAAGTAAATGG + Intergenic
931673823 2:64673308-64673330 TAAGGACCCCTGTAATTACACGG + Intronic
933589453 2:84215682-84215704 TGGGGCCTTCTGAAATTACATGG - Intergenic
937872909 2:126798687-126798709 TGGGGACCCCTGCAGGAGCAGGG - Intergenic
944722026 2:202433304-202433326 AGGGGACCTCAGAAAGTTCATGG + Intronic
949086407 2:242159609-242159631 TGGGGACCTCAGTAAGTAAAGGG + Intergenic
1169562134 20:6813121-6813143 TGGAGACCCTGGAAAGAACATGG - Intergenic
1171462728 20:25308117-25308139 AGGGGCCCCCAGAAAGCACAAGG + Intronic
1173189170 20:40863139-40863161 TGGGTAGCCATGAAAGGACAAGG + Intergenic
1173504079 20:43573545-43573567 TGGGGACCCCTTCAGGTCCAAGG - Intronic
1173899354 20:46575766-46575788 TGGGGACCCCTGAGTGTCCCCGG - Intronic
1175579242 20:60086451-60086473 TGGGGACCGGAGAAAGAACATGG - Intergenic
1178947281 21:36959118-36959140 CTGGGACCCCTGAGAGTGCAGGG - Intronic
1180869788 22:19139642-19139664 TGTGGAGACCTGGAAGTACAAGG - Exonic
1183198068 22:36367074-36367096 AGGGGACTCCTAAAAGTCCATGG - Intronic
950196171 3:11010885-11010907 TGGGGAGCCCTGAAAAGCCAGGG - Intronic
953328990 3:42036079-42036101 TGCGGCCCCTTGAAAGTAAAGGG + Intronic
955148281 3:56341789-56341811 TGGTGATCCCTGAAAACACAGGG + Intronic
956876777 3:73471578-73471600 TGAGGACCCCTCAGAGGACATGG - Intronic
957459843 3:80502091-80502113 TGGGGAACCCAAACAGTACATGG - Intergenic
959446998 3:106452924-106452946 TGGGGAACCAGGAAAGCACATGG + Intergenic
961207662 3:125099034-125099056 TGGGGAGGCCTGAAAGAACCTGG + Intronic
961522260 3:127473608-127473630 AGGGGACCCCTGTAAGTGGAGGG - Intergenic
962626114 3:137227555-137227577 TGGGGATCCCTGAAAATACTTGG + Intergenic
966821084 3:183925049-183925071 TGGGAACGCCTGAAACAACAGGG + Intronic
968086688 3:195877054-195877076 GGGGGTCCCCTGGAAGTACCTGG - Intronic
970193222 4:13534132-13534154 TAGGGACCTCTGAGAATACAGGG - Intergenic
983039993 4:162914215-162914237 TGGGGACACATGAAAGTGCCTGG - Intergenic
985475977 5:79358-79380 TGGGCACACCTGAGACTACAAGG - Intergenic
985619159 5:944615-944637 TAAGGACCCCTGGAAGCACAGGG - Intergenic
986458061 5:7940351-7940373 GAGGCACCCCTGAGAGTACAAGG - Intergenic
986460595 5:7967067-7967089 TGGGGTCCAGTGAAATTACAGGG + Intergenic
988612239 5:32737592-32737614 TGGAGAGCTCTGAAAATACAAGG - Intronic
990546557 5:56827440-56827462 TGTGAACCTCTGAAACTACATGG - Intronic
991580012 5:68145088-68145110 TGGGGACTACTAAAGGTACAGGG + Intergenic
999037611 5:148370802-148370824 ACAGGACCCCTGTAAGTACATGG + Intergenic
1000301384 5:159959610-159959632 TGTGAGCCCCTGAAATTACATGG + Intronic
1000861053 5:166456552-166456574 TGGAGACACCTGAATGTACCTGG - Intergenic
1002261329 5:177995678-177995700 TGGGAACCTTTGAAAGTAAAAGG - Intronic
1002571787 5:180143773-180143795 TGGGGACCCCAGCAGGAACAGGG - Intronic
1002744885 5:181462455-181462477 TGGGGACCTCAGTAAGTAAAGGG + Intergenic
1003378512 6:5601560-5601582 TGGGGAGGCCTCAAAGTACAGGG + Intronic
1003631974 6:7795443-7795465 TGGGGATCCCTGAACTAACAGGG - Intronic
1011564965 6:88664559-88664581 GGGGTCCCCCTGAAAGGACAAGG + Intronic
1012856835 6:104512291-104512313 AGGGGGCCCATGAAAGTTCAGGG - Intergenic
1015264854 6:131280630-131280652 TGGGGACCCAGGAAAGAACAAGG - Intronic
1016629921 6:146216720-146216742 AGGTGGCTCCTGAAAGTACACGG - Intronic
1022456630 7:30563805-30563827 TGGGGCTCCCAGAAACTACACGG - Intergenic
1027000865 7:74653278-74653300 TAGGAACCCCTGAAAGCCCACGG - Intergenic
1032452020 7:132039865-132039887 TGGGGACCTTTGTAAATACATGG + Intergenic
1035498299 8:71660-71682 TGGGGACCTCAGTAAGTAAAGGG - Intergenic
1036740329 8:11355295-11355317 TGGGGACCCGTTGAAGAACATGG + Intergenic
1037209600 8:16370646-16370668 TAAGGACCCTTGAAACTACATGG - Intronic
1037784547 8:21894870-21894892 GGGGGACCTCTGAAAGCAGAGGG + Intergenic
1038652880 8:29421677-29421699 TGGGGACCACTGAAAGTGCATGG - Intergenic
1049472307 8:142781962-142781984 TAGGGACCCCTGGAGGCACAGGG + Intergenic
1056260053 9:84839879-84839901 TGGGAAGCTCTGAAACTACAGGG + Intronic
1057997061 9:99828437-99828459 TGGGGACTGCTTGAAGTACATGG - Exonic
1060263889 9:122098835-122098857 TGGGGACCCCTGAAGCTATATGG + Intergenic
1060827961 9:126697101-126697123 TGGGGACACCAGAAGGGACAGGG + Exonic
1203610696 Un_KI270748v1:92934-92956 TGGGGACCTCAGTAAGTAAAGGG + Intergenic
1194564947 X:95473985-95474007 TGGGAACCCAGGAAAGTATAAGG - Intergenic
1195091008 X:101459015-101459037 TTGGGACCCCTGATAATACTGGG + Intronic
1196783594 X:119403618-119403640 GGGGGACCTCAGAAAGGACAGGG - Intronic