ID: 1083150621

View in Genome Browser
Species Human (GRCh38)
Location 11:60789701-60789723
Sequence GTTGGAATGAGGACAAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083150613_1083150621 21 Left 1083150613 11:60789657-60789679 CCTCATCTGCAAAATGAGAGTGA 0: 1
1: 16
2: 121
3: 802
4: 3268
Right 1083150621 11:60789701-60789723 GTTGGAATGAGGACAAAATCAGG 0: 1
1: 0
2: 0
3: 20
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083150621 Original CRISPR GTTGGAATGAGGACAAAATC AGG Intronic
902094633 1:13932780-13932802 GCTGGAATGATTCCAAAATCTGG + Intergenic
902704519 1:18195408-18195430 GTTGGAATGAGGATCAGAACAGG + Intronic
902904337 1:19543695-19543717 TTTGTAATGAAGAAAAAATCAGG + Intergenic
905334354 1:37233913-37233935 GGTGGAGTGAGGATCAAATCAGG + Intergenic
906243291 1:44255902-44255924 GTTCAAATTAGGACAAAATGTGG - Intronic
908647106 1:66290057-66290079 GGTGGATTGAGGAAAAACTCAGG + Intronic
908678149 1:66629264-66629286 GCTGTAATGATGACCAAATCAGG - Intronic
910655652 1:89615521-89615543 GTTGGAATGAGCACAGGCTCAGG - Intergenic
913050330 1:115112075-115112097 ATTTGACTGAGGACAAAATGAGG + Intergenic
914338456 1:146738289-146738311 GTTGGAAGGAGAGCAGAATCAGG - Intergenic
915074912 1:153299961-153299983 GTTGGAAGGAGGCAAAACTCTGG - Intronic
916155380 1:161840292-161840314 AGTGGAATGAGCACAAAATTTGG - Intronic
916186584 1:162139149-162139171 GAGGGAATGAGGTCAAAACCCGG - Intronic
917202942 1:172536490-172536512 GTAGGTATGAGAACAAAATGTGG - Intronic
917552406 1:176047299-176047321 GTTGTTATGAGGACTAAATGAGG - Intronic
919413651 1:197278699-197278721 GTTGGAAAGAGGAAAAAAGATGG - Intronic
919896828 1:202014136-202014158 CTTAGAGTGAGGACAACATCTGG + Intronic
922584848 1:226725837-226725859 GTTGGGATGAGGAGATATTCTGG - Intronic
923187238 1:231586126-231586148 GTTGGAGTCAGGACAAAATGGGG + Intronic
1064555646 10:16544717-16544739 GTGTGAATGAGGAGAAAAGCTGG + Intergenic
1066411394 10:35173349-35173371 GTTGGTATGTGAAGAAAATCTGG - Intronic
1068457625 10:57278724-57278746 GTGGGGATGAGGAAAAAATGGGG + Intergenic
1068544654 10:58332206-58332228 CATGGAATGAGGACAGAATCAGG - Intergenic
1069780230 10:70950732-70950754 GCTGGAATGAGGGCAAAGCCAGG - Intergenic
1072321284 10:94252584-94252606 TTTGGGTTGAGGACAAAGTCAGG + Intronic
1074572657 10:114638460-114638482 GTTGTTATGAGGACAAGATGAGG - Intronic
1074861357 10:117512620-117512642 GTTGTTATGAGGACTAAATGAGG + Intergenic
1075288207 10:121205216-121205238 GGTGGTATGAGGACTAAATGGGG - Intergenic
1075834402 10:125441368-125441390 TTTGGGATGATGACAAATTCTGG + Intergenic
1079931572 11:26569581-26569603 GTTGGCATGAGGTCAAACTTCGG - Intronic
1081299447 11:41432771-41432793 GGTGTAATGAGACCAAAATCAGG + Intronic
1083150621 11:60789701-60789723 GTTGGAATGAGGACAAAATCAGG + Intronic
1089495249 11:118905037-118905059 GTTGGTATGAGGAGTAAATGAGG - Intronic
1090043464 11:123310758-123310780 TTTCAGATGAGGACAAAATCAGG - Intergenic
1090231327 11:125107400-125107422 GTTCGAATCAGGACCAAATAAGG - Intronic
1091844731 12:3647132-3647154 GGTGGAATCAGGACAACAGCTGG - Intronic
1092045507 12:5429870-5429892 GTTGGAAATAAGACAAACTCTGG + Intergenic
1092148276 12:6229627-6229649 GTGTGAAGGAGAACAAAATCCGG - Intronic
1093603061 12:21054008-21054030 GTTTGAAAGGGGCCAAAATCTGG - Intronic
1095734267 12:45539252-45539274 GTTGTTATGAAGACAAAATAAGG + Intergenic
1095825577 12:46527237-46527259 AATTGAATGAGGGCAAAATCAGG + Intergenic
1096511190 12:52130095-52130117 GTTAGATTAAGTACAAAATCAGG + Intergenic
1100867097 12:98868629-98868651 TTTGGAATGAAGAGAAAATCTGG + Intronic
1101632277 12:106506660-106506682 CTTTGAAAGAGGACTAAATCAGG + Intronic
1101796293 12:107977473-107977495 GCTGGAATGAGGACAAATTTGGG + Intergenic
1102066102 12:109977108-109977130 TTTGGAATGAAGGCAAAATAAGG - Intronic
1102097611 12:110252828-110252850 GGGAGAATGAGGACCAAATCAGG - Intergenic
1103241361 12:119416070-119416092 GTTGGCATGAGGATTAAATAAGG + Intronic
1103250415 12:119495079-119495101 GTTGGAATGAGGCTTAAATGAGG - Intronic
1103388122 12:120549916-120549938 GTTGGAGTCAGGACTAAACCTGG + Intronic
1108133622 13:47331491-47331513 ACTGGAATGAGAACAAAATGAGG + Intergenic
1110181013 13:72616787-72616809 ATTGCCTTGAGGACAAAATCTGG - Intergenic
1110802294 13:79712990-79713012 GGTTGTATCAGGACAAAATCTGG + Intergenic
1112211242 13:97379784-97379806 TTTGGAATGAGGAGACATTCTGG + Intronic
1112228604 13:97565688-97565710 GCTGGAATCAGGCAAAAATCGGG + Intergenic
1114041833 14:18685835-18685857 GTTGAAATGAAGATAAAATGAGG + Intergenic
1114367934 14:22050287-22050309 GAGGAAATGAGGACACAATCTGG + Intergenic
1116660340 14:47701813-47701835 ATTGGAATGTGGACAAGACCTGG + Intergenic
1117660190 14:57996420-57996442 GTATGTATGAGGACAACATCTGG - Intergenic
1117918911 14:60707251-60707273 GTTGTAATGTGGCCAAAATCAGG + Intergenic
1118138807 14:63057074-63057096 GATGGAATCAGGAACAAATCAGG + Intronic
1118522404 14:66599255-66599277 ATTGGAATGAGGATAAATTTGGG - Intronic
1120298134 14:82671240-82671262 GATGCAATGATGACAAAACCTGG - Intergenic
1120552977 14:85893801-85893823 GATGGCATGAGAACAAAACCTGG + Intergenic
1120711229 14:87795281-87795303 GTTGTGATGAGGACTAAATGTGG + Intergenic
1121173681 14:91874772-91874794 GATGGAATGAGGGAAACATCTGG - Intronic
1121513772 14:94535242-94535264 TTTGGAGTGAGGACTATATCTGG + Intergenic
1125356564 15:38822715-38822737 GTTGGAATGAAACCAAAATAAGG - Intergenic
1125709517 15:41773738-41773760 AATGGAATGAGGAAAAGATCTGG + Intergenic
1127251532 15:57243831-57243853 ATTGGAATGAAGATAAAATATGG + Intronic
1131362685 15:91807265-91807287 GTTGTAATGAGGATTAAATTAGG + Intergenic
1133001570 16:2854026-2854048 GGAGGAAAGAGGACAGAATCAGG + Intronic
1133055014 16:3141553-3141575 GGGGGAAAGAGGACAAGATCGGG - Exonic
1135792898 16:25414254-25414276 GTTGTTATGAGGAGAAAATGAGG + Intergenic
1135881426 16:26261445-26261467 GTTGTAGTGAGGACTAAATGAGG + Intergenic
1137810427 16:51347287-51347309 GTTGGAAGGAAGGCAAAATGAGG - Intergenic
1138104933 16:54282795-54282817 GTTGGAAGGAGGATGGAATCTGG + Intergenic
1139844455 16:69909904-69909926 GATGGCCTGTGGACAAAATCCGG + Intronic
1139995822 16:70979065-70979087 GTTGGAAGGAGAGCAGAATCAGG + Intronic
1140738319 16:77918757-77918779 GTTGGAAGGAGGAGAAAAATGGG - Intronic
1141180356 16:81748789-81748811 GTTGTAATGAGGATAAGATGTGG - Intronic
1143208631 17:5166077-5166099 GTTGGAATGAGTAGAAAAAGGGG - Intronic
1144322238 17:14138811-14138833 GCTGGGATGAGGAGACAATCAGG - Intronic
1144617958 17:16794188-16794210 GTTGGAATGAGTAGAAAAAGGGG - Intronic
1144894747 17:18521495-18521517 GTTGGAATGAGTAGAAAAAGGGG + Intergenic
1145137475 17:20422736-20422758 GTTGGAATGAGTAGAAAAAGGGG - Intergenic
1149245021 17:54695765-54695787 GATGGAATTATGACACAATCAGG + Intergenic
1149321171 17:55482541-55482563 GTTTGCTTGAGGACAGAATCTGG + Intergenic
1149530044 17:57388007-57388029 AGTGGAAAGAGGACAAACTCAGG - Intronic
1149606126 17:57926377-57926399 GCTTGAATGGGGACAAGATCCGG - Intronic
1149871652 17:60187490-60187512 GTTGGAATGAGTAGAAAAAGGGG + Intronic
1150871727 17:68919388-68919410 ATTGGATTGTGGACAAACTCCGG + Exonic
1152466687 17:80470654-80470676 GTGTGCATGAGGACAAAACCAGG + Exonic
1153677901 18:7471548-7471570 GTTGGAGTGACCATAAAATCAGG + Intergenic
1155097760 18:22575754-22575776 GTAGTAATGATGCCAAAATCAGG - Intergenic
1155428109 18:25726881-25726903 GATGGAAAGAAGACAAATTCTGG + Intergenic
1158929870 18:62313680-62313702 GTTGGAAGGAGTAAACAATCAGG + Intergenic
1163090415 19:15015634-15015656 GTTGGGATGATGAAAAATTCTGG + Intronic
1163193667 19:15698035-15698057 GTTGTCCTGAGGACAAAATGTGG + Intergenic
1163297879 19:16424151-16424173 CCTGGCATGAGGGCAAAATCGGG + Intronic
1164930187 19:32169380-32169402 ACATGAATGAGGACAAAATCAGG + Intergenic
925841346 2:7995023-7995045 ATGGGAATGAGGATAAACTCTGG - Intergenic
926798269 2:16636711-16636733 GTTGGAAGTAGGACAACTTCAGG + Intronic
926949000 2:18220924-18220946 GATGGAATGCAGACAAAATGGGG + Intronic
928638427 2:33272296-33272318 GTTTGAATGAGAAGAAAAGCAGG - Intronic
930603516 2:53469092-53469114 GTTGGAATGAGGGAAAATTAAGG - Intergenic
930899713 2:56489839-56489861 TTTAGAATGAGGACACAGTCTGG + Intergenic
931087045 2:58844047-58844069 GTTTGAATGAGGACAAGAGACGG + Intergenic
935834159 2:107031878-107031900 GTGGGAATGAGGACGATATATGG + Intergenic
937798924 2:126059058-126059080 GTTACAATGTGGACAAACTCAGG + Intergenic
938105442 2:128526850-128526872 GATCGAATGAGCACAAACTCAGG - Intergenic
940484456 2:154279397-154279419 GTAGAAATGAGTAGAAAATCAGG + Intronic
941701832 2:168612106-168612128 GTTAGAATGAGGATTAAATGAGG - Intronic
942743668 2:179207380-179207402 GTTGTCATGTGGACAGAATCAGG - Intronic
943330421 2:186552208-186552230 TTTGGAATTTGGATAAAATCGGG + Intergenic
945499458 2:210552571-210552593 TTTGGAATGAAGAGAAAATAAGG - Intronic
946189000 2:217997350-217997372 TTTGGATTCAGGACACAATCAGG + Intronic
946334557 2:219028466-219028488 GTTGAACTGAGGACAGAAGCTGG + Intronic
946469858 2:219948745-219948767 GTTGGAGTGAAGACAAAAATTGG + Intergenic
947035370 2:225847704-225847726 GTTGAAATGAGAACAAAAGATGG - Intergenic
948695494 2:239731251-239731273 GTTGGGATGAGGATACAATTAGG - Intergenic
1169368792 20:5012405-5012427 GTTGGTATGAGGATTAAATGAGG + Intergenic
1172551177 20:35801354-35801376 GTTAGAATGAGGACACCAACAGG + Intronic
1173404543 20:42753320-42753342 GCTGCAATTAGGAAAAAATCAGG + Intronic
1174598146 20:51701270-51701292 GCAGGACAGAGGACAAAATCAGG + Intronic
1179567348 21:42257613-42257635 GTTGGAATGTGGCCAAAGTGAGG - Intronic
1181138612 22:20787105-20787127 GTTGGAATGGAAACAAAATGAGG - Exonic
1181981468 22:26769728-26769750 GTTGTTAGGAGGACAAAATGAGG + Intergenic
1182547370 22:31084042-31084064 GTTGGCATGGGGACAGAATGAGG + Intronic
1185187283 22:49408797-49408819 GTTGGAAAGAGAAAAAAATTGGG - Intergenic
949316070 3:2757025-2757047 CTTTGAATGAGATCAAAATCAGG + Intronic
949332229 3:2935161-2935183 GTTAAAATGATGACTAAATCCGG + Intronic
950338335 3:12218676-12218698 TTTGGAATGACAACAAAATTAGG + Intergenic
950649101 3:14396256-14396278 GTTAGAATGAGAATAAAATGAGG + Intergenic
952830337 3:37559411-37559433 GTTGGTGTGAGGATAAAATGAGG + Intronic
954510967 3:51124742-51124764 GTTGGAATGAGTACAGATTTTGG + Intronic
955715724 3:61827428-61827450 GGTGGAAGGTGGACAGAATCTGG + Intronic
956014388 3:64866195-64866217 GTGGGTATGATTACAAAATCAGG - Intergenic
956325968 3:68053445-68053467 GTAGGAATGGAAACAAAATCAGG + Intronic
956755934 3:72386582-72386604 GATGAAATGAGGACAAAATTAGG + Intronic
962491730 3:135900538-135900560 TTTGGAATGATGAAAAATTCTGG - Intergenic
964341519 3:155713544-155713566 GTTGGAATGGGAAGAAAATCTGG + Intronic
964488148 3:157206964-157206986 GTAGGTATGAGGAGAAAATCAGG - Intergenic
965158806 3:165103263-165103285 GATTTAATGAGGAAAAAATCTGG + Intergenic
967246450 3:187491679-187491701 GTTGGCATGTGGACAAACTCAGG - Intergenic
971158477 4:24108478-24108500 CTTAGAATGAGAAGAAAATCAGG + Intergenic
971934443 4:33129721-33129743 ATTGGAATAAGGAGAAAATATGG - Intergenic
972294563 4:37724256-37724278 GTTGCAATGATCACAGAATCAGG + Intergenic
974365310 4:60940536-60940558 GTTGGAAGGAAAACAAAATTTGG + Intergenic
975559612 4:75696724-75696746 CATGGAAAGAGGACTAAATCAGG + Intronic
975804207 4:78095937-78095959 GTTGGAATGAGGTAAGACTCTGG - Intronic
976224221 4:82782457-82782479 ATTGGTGTGAGGACTAAATCAGG - Intronic
977987276 4:103397972-103397994 ATTGGAATTAGGACCAAATAAGG + Intergenic
978513376 4:109546050-109546072 GAAGGAGTGAGGACAAAATTGGG + Intergenic
979700210 4:123658353-123658375 GAATGAATGAGGAAAAAATCTGG - Intergenic
981541830 4:145854184-145854206 GTTGGGCTGAGGAGAAATTCAGG + Intronic
983632986 4:169868598-169868620 GTGGGAATGGGGACAAAGTGGGG - Intergenic
988101050 5:26679390-26679412 CTTGGAATGAGGAAAGAATCTGG + Intergenic
988129867 5:27090040-27090062 CTTGGAATCAGGCCAAAATTTGG - Intronic
989180653 5:38573757-38573779 GTGGGAGTGGTGACAAAATCAGG - Intronic
993143671 5:84067244-84067266 TTTGGAATGGGGAGAAAATATGG - Intronic
994055013 5:95405230-95405252 GTTGGAATGATGAGAAAATGTGG + Intronic
997446806 5:133946364-133946386 GGTGGAATCAGGACAAGATATGG + Intergenic
997556794 5:134806343-134806365 GTTGGTATGTGAACAAAATTGGG + Intronic
997753130 5:136369093-136369115 TTTAGAGTGAGCACAAAATCTGG + Intronic
1000504552 5:162098942-162098964 GTTGCTATAAGGACAAAATAGGG + Intronic
1001070414 5:168580130-168580152 GTCGGAATGATGACAATAGCAGG + Intergenic
1001307809 5:170588547-170588569 GTTGGAATCAGGAGAAAGGCAGG + Intronic
1001482941 5:172101082-172101104 GTTGGTATGAGGATTAAATTAGG + Intronic
1001702605 5:173718174-173718196 GCTGGAATGAGGATAAGCTCTGG - Intergenic
1001801300 5:174546627-174546649 TTTGGTATGAGGACTAAATAAGG - Intergenic
1002821848 6:733064-733086 CTTGGAATGAAGACAAAAGTAGG + Intergenic
1004398026 6:15263376-15263398 CTTGGAAGGAGAAGAAAATCAGG - Intronic
1005510311 6:26506610-26506632 TTTGGAATGTGGAGAAAAGCTGG + Intronic
1006409480 6:33864008-33864030 GCTGTAATGAGCACAAAACCAGG + Intergenic
1007904068 6:45441294-45441316 GTTTGAACAAGGACAAATTCTGG + Intronic
1008166001 6:48139081-48139103 GTAGGGATGATGAAAAAATCAGG + Intergenic
1011007053 6:82657328-82657350 GCTGGAGTGAGGACAAAATGTGG - Intergenic
1012852728 6:104466399-104466421 GTTGGAATGAAGGCAAAAAGTGG - Intergenic
1014084266 6:117324887-117324909 TATGGCATGAGGACCAAATCTGG + Intronic
1014711863 6:124815889-124815911 ATTGGTATGAGGATAAAATAAGG - Intronic
1015040609 6:128713641-128713663 TTTGGATTGAGGACTACATCTGG + Intergenic
1017996391 6:159534941-159534963 GTTGAAATGAGGACCAAAATGGG + Intergenic
1020974651 7:14989552-14989574 GTTGGAGTGTGGAAGAAATCAGG + Intergenic
1022263251 7:28727886-28727908 GCTGTACTGAGGAGAAAATCAGG - Intronic
1022523621 7:31023331-31023353 GCAGGAATGAGGACACACTCAGG - Intergenic
1023322919 7:39019053-39019075 GTAGGAATGAGGAAAATATAAGG - Intronic
1024184919 7:46940084-46940106 ATTGGAATGAGGACACTATTCGG + Intergenic
1024623798 7:51187433-51187455 GTTGGAATAAATGCAAAATCTGG + Intronic
1027749820 7:82128707-82128729 GTTGGCATCAGGACAAAATTTGG - Intronic
1028264605 7:88706746-88706768 GCTGGAAGGAGGAGAAAATGAGG - Intergenic
1033410765 7:141115403-141115425 GTAGGAATGAGCAGAAAAGCCGG + Intronic
1037476416 8:19262260-19262282 TTTGGAAGGAGGAAAAGATCAGG - Intergenic
1037636990 8:20708998-20709020 GATAGAATGAGGGCAAAAGCGGG + Intergenic
1038159482 8:25023129-25023151 TTTGGAATGAGGACCACATGGGG + Intergenic
1038184838 8:25263892-25263914 ATGGGAATCAGGACAGAATCAGG - Intronic
1040488570 8:47897985-47898007 GATGGAATAAGGGCAAAAACTGG + Intronic
1042509964 8:69600916-69600938 GATGGAATGAGGACAAGATAAGG - Intronic
1042951860 8:74208606-74208628 TTTGGAATGATGAAAAATTCTGG - Intergenic
1046016022 8:108606306-108606328 GCTGGAATGAGGAGCAAATTGGG - Intergenic
1047847194 8:128819398-128819420 GTTACAATGAGGACAATATCTGG + Intergenic
1048147876 8:131863136-131863158 GTTGGAAAGAGATCAAGATCAGG - Intergenic
1049815183 8:144595905-144595927 GTGGCAAAGAGGACAACATCTGG - Intronic
1051874130 9:21772685-21772707 AGAGGAATGAGGACAAAGTCAGG - Intergenic
1058998410 9:110322743-110322765 GTTGGTACCAGGACAGAATCAGG + Intronic
1059605078 9:115825444-115825466 GCTGGAATGAGTTAAAAATCTGG + Intergenic
1061653713 9:132071116-132071138 GGTGTTATGAGGACAAAATGAGG - Intronic
1185570763 X:1133162-1133184 CTTGAAATTAGGAAAAAATCCGG + Intergenic
1185835050 X:3337841-3337863 GTGGGAATGAGGACAAACTTGGG + Intronic
1188287763 X:28349093-28349115 GGTGGAATCAGGACTAAAACTGG + Intergenic
1189178059 X:38978083-38978105 GATGGCATGAGGACAAAATAAGG - Intergenic
1190452091 X:50592558-50592580 GTTGGAATGTGAACAGAATATGG + Exonic
1191214982 X:57924382-57924404 GTTGGGACTTGGACAAAATCAGG + Intergenic
1193272408 X:79544848-79544870 GTTACAATGAGGACAAAATTGGG + Intergenic
1194224854 X:91244304-91244326 GTTGTCATGTGGACAGAATCAGG + Intergenic
1194497685 X:94637301-94637323 GTTGGAATGAAGACTACATTTGG - Intergenic
1195661210 X:107380385-107380407 ATTGGAATAAGGAAAAAAGCGGG + Intergenic
1195772839 X:108370672-108370694 GTTTGGATGTGGACCAAATCGGG - Intronic
1195919034 X:109964194-109964216 GTTGGAATGTTGACAAGATGGGG - Intergenic
1198064567 X:133083774-133083796 GTTGGGAAGAGGTCAAAATTAGG + Intronic
1198582569 X:138082130-138082152 GTTGGGATGGGGAGAAAATGAGG + Intergenic
1200561316 Y:4707614-4707636 GTTGTCATGTGGACAGAATCAGG + Intergenic
1200703874 Y:6425079-6425101 GTAGGAGTGAGGATACAATCTGG - Intergenic
1200739033 Y:6832961-6832983 GTTGGAATGAGGAAAAATCTTGG - Intergenic
1200923824 Y:8636642-8636664 GTAGCAATGAGGATAAAATCTGG + Intergenic
1200984506 Y:9291297-9291319 ATAGGAGTGAGGACAAAATCTGG - Intergenic
1201030237 Y:9739628-9739650 GTAGGAGTGAGGATACAATCTGG + Intergenic
1202182274 Y:22149768-22149790 GATGGAGTGAGGATACAATCTGG - Intergenic
1202209086 Y:22436634-22436656 GATGGAGTGAGGATACAATCTGG + Intergenic