ID: 1083153085

View in Genome Browser
Species Human (GRCh38)
Location 11:60805778-60805800
Sequence ATGGAGACGGAGAAGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083153085_1083153094 4 Left 1083153085 11:60805778-60805800 CCCTCTTCCTTCTCCGTCTCCAT No data
Right 1083153094 11:60805805-60805827 TTAAGGCAGGTCACAGAGGCAGG No data
1083153085_1083153092 0 Left 1083153085 11:60805778-60805800 CCCTCTTCCTTCTCCGTCTCCAT No data
Right 1083153092 11:60805801-60805823 GACCTTAAGGCAGGTCACAGAGG No data
1083153085_1083153095 8 Left 1083153085 11:60805778-60805800 CCCTCTTCCTTCTCCGTCTCCAT No data
Right 1083153095 11:60805809-60805831 GGCAGGTCACAGAGGCAGGACGG No data
1083153085_1083153090 -9 Left 1083153085 11:60805778-60805800 CCCTCTTCCTTCTCCGTCTCCAT No data
Right 1083153090 11:60805792-60805814 CGTCTCCATGACCTTAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083153085 Original CRISPR ATGGAGACGGAGAAGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr