ID: 1083154219

View in Genome Browser
Species Human (GRCh38)
Location 11:60812704-60812726
Sequence CCTCTCCTTTTTTTCAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083154219_1083154226 22 Left 1083154219 11:60812704-60812726 CCCTGGCTGAAAAAAAGGAGAGG No data
Right 1083154226 11:60812749-60812771 CATCATCCACCTCCAGTCCTGGG No data
1083154219_1083154229 29 Left 1083154219 11:60812704-60812726 CCCTGGCTGAAAAAAAGGAGAGG No data
Right 1083154229 11:60812756-60812778 CACCTCCAGTCCTGGGCATAGGG No data
1083154219_1083154225 21 Left 1083154219 11:60812704-60812726 CCCTGGCTGAAAAAAAGGAGAGG No data
Right 1083154225 11:60812748-60812770 GCATCATCCACCTCCAGTCCTGG No data
1083154219_1083154228 28 Left 1083154219 11:60812704-60812726 CCCTGGCTGAAAAAAAGGAGAGG No data
Right 1083154228 11:60812755-60812777 CCACCTCCAGTCCTGGGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083154219 Original CRISPR CCTCTCCTTTTTTTCAGCCA GGG (reversed) Intergenic