ID: 1083154221

View in Genome Browser
Species Human (GRCh38)
Location 11:60812705-60812727
Sequence CCCTCTCCTTTTTTTCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083154221_1083154225 20 Left 1083154221 11:60812705-60812727 CCTGGCTGAAAAAAAGGAGAGGG No data
Right 1083154225 11:60812748-60812770 GCATCATCCACCTCCAGTCCTGG No data
1083154221_1083154228 27 Left 1083154221 11:60812705-60812727 CCTGGCTGAAAAAAAGGAGAGGG No data
Right 1083154228 11:60812755-60812777 CCACCTCCAGTCCTGGGCATAGG No data
1083154221_1083154229 28 Left 1083154221 11:60812705-60812727 CCTGGCTGAAAAAAAGGAGAGGG No data
Right 1083154229 11:60812756-60812778 CACCTCCAGTCCTGGGCATAGGG No data
1083154221_1083154226 21 Left 1083154221 11:60812705-60812727 CCTGGCTGAAAAAAAGGAGAGGG No data
Right 1083154226 11:60812749-60812771 CATCATCCACCTCCAGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083154221 Original CRISPR CCCTCTCCTTTTTTTCAGCC AGG (reversed) Intergenic