ID: 1083154225 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:60812748-60812770 |
Sequence | GCATCATCCACCTCCAGTCC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1083154219_1083154225 | 21 | Left | 1083154219 | 11:60812704-60812726 | CCCTGGCTGAAAAAAAGGAGAGG | 0: 1 1: 0 2: 3 3: 56 4: 553 |
||
Right | 1083154225 | 11:60812748-60812770 | GCATCATCCACCTCCAGTCCTGG | No data | ||||
1083154221_1083154225 | 20 | Left | 1083154221 | 11:60812705-60812727 | CCTGGCTGAAAAAAAGGAGAGGG | No data | ||
Right | 1083154225 | 11:60812748-60812770 | GCATCATCCACCTCCAGTCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1083154225 | Original CRISPR | GCATCATCCACCTCCAGTCC TGG | Intergenic | ||