ID: 1083154228

View in Genome Browser
Species Human (GRCh38)
Location 11:60812755-60812777
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083154221_1083154228 27 Left 1083154221 11:60812705-60812727 CCTGGCTGAAAAAAAGGAGAGGG No data
Right 1083154228 11:60812755-60812777 CCACCTCCAGTCCTGGGCATAGG No data
1083154219_1083154228 28 Left 1083154219 11:60812704-60812726 CCCTGGCTGAAAAAAAGGAGAGG No data
Right 1083154228 11:60812755-60812777 CCACCTCCAGTCCTGGGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083154228 Original CRISPR CCACCTCCAGTCCTGGGCAT AGG Intergenic