ID: 1083155154

View in Genome Browser
Species Human (GRCh38)
Location 11:60818297-60818319
Sequence GTGGGGATAGAGACCCCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083155154_1083155158 8 Left 1083155154 11:60818297-60818319 CCTGTAGGGGTCTCTATCCCCAC No data
Right 1083155158 11:60818328-60818350 CACCCACCAGCTTTTCCTGATGG No data
1083155154_1083155163 30 Left 1083155154 11:60818297-60818319 CCTGTAGGGGTCTCTATCCCCAC No data
Right 1083155163 11:60818350-60818372 GTTGCTCTACCCCACTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083155154 Original CRISPR GTGGGGATAGAGACCCCTAC AGG (reversed) Intergenic