ID: 1083155155

View in Genome Browser
Species Human (GRCh38)
Location 11:60818314-60818336
Sequence TGGTGGGTGATGCTATTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083155155_1083155163 13 Left 1083155155 11:60818314-60818336 CCCCACAATAGCATCACCCACCA No data
Right 1083155163 11:60818350-60818372 GTTGCTCTACCCCACTGTCATGG No data
1083155155_1083155158 -9 Left 1083155155 11:60818314-60818336 CCCCACAATAGCATCACCCACCA No data
Right 1083155158 11:60818328-60818350 CACCCACCAGCTTTTCCTGATGG No data
1083155155_1083155166 23 Left 1083155155 11:60818314-60818336 CCCCACAATAGCATCACCCACCA No data
Right 1083155166 11:60818360-60818382 CCCACTGTCATGGCCCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083155155 Original CRISPR TGGTGGGTGATGCTATTGTG GGG (reversed) Intergenic
No off target data available for this crispr