ID: 1083155156

View in Genome Browser
Species Human (GRCh38)
Location 11:60818315-60818337
Sequence CTGGTGGGTGATGCTATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083155156_1083155166 22 Left 1083155156 11:60818315-60818337 CCCACAATAGCATCACCCACCAG No data
Right 1083155166 11:60818360-60818382 CCCACTGTCATGGCCCAAACAGG No data
1083155156_1083155163 12 Left 1083155156 11:60818315-60818337 CCCACAATAGCATCACCCACCAG No data
Right 1083155163 11:60818350-60818372 GTTGCTCTACCCCACTGTCATGG No data
1083155156_1083155158 -10 Left 1083155156 11:60818315-60818337 CCCACAATAGCATCACCCACCAG No data
Right 1083155158 11:60818328-60818350 CACCCACCAGCTTTTCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083155156 Original CRISPR CTGGTGGGTGATGCTATTGT GGG (reversed) Intergenic