ID: 1083155156 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:60818315-60818337 |
Sequence | CTGGTGGGTGATGCTATTGT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1083155156_1083155166 | 22 | Left | 1083155156 | 11:60818315-60818337 | CCCACAATAGCATCACCCACCAG | No data | ||
Right | 1083155166 | 11:60818360-60818382 | CCCACTGTCATGGCCCAAACAGG | No data | ||||
1083155156_1083155163 | 12 | Left | 1083155156 | 11:60818315-60818337 | CCCACAATAGCATCACCCACCAG | No data | ||
Right | 1083155163 | 11:60818350-60818372 | GTTGCTCTACCCCACTGTCATGG | No data | ||||
1083155156_1083155158 | -10 | Left | 1083155156 | 11:60818315-60818337 | CCCACAATAGCATCACCCACCAG | No data | ||
Right | 1083155158 | 11:60818328-60818350 | CACCCACCAGCTTTTCCTGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1083155156 | Original CRISPR | CTGGTGGGTGATGCTATTGT GGG (reversed) | Intergenic | ||