ID: 1083155157

View in Genome Browser
Species Human (GRCh38)
Location 11:60818316-60818338
Sequence GCTGGTGGGTGATGCTATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083155157_1083155166 21 Left 1083155157 11:60818316-60818338 CCACAATAGCATCACCCACCAGC No data
Right 1083155166 11:60818360-60818382 CCCACTGTCATGGCCCAAACAGG No data
1083155157_1083155163 11 Left 1083155157 11:60818316-60818338 CCACAATAGCATCACCCACCAGC No data
Right 1083155163 11:60818350-60818372 GTTGCTCTACCCCACTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083155157 Original CRISPR GCTGGTGGGTGATGCTATTG TGG (reversed) Intergenic
No off target data available for this crispr