ID: 1083155158

View in Genome Browser
Species Human (GRCh38)
Location 11:60818328-60818350
Sequence CACCCACCAGCTTTTCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083155155_1083155158 -9 Left 1083155155 11:60818314-60818336 CCCCACAATAGCATCACCCACCA No data
Right 1083155158 11:60818328-60818350 CACCCACCAGCTTTTCCTGATGG No data
1083155156_1083155158 -10 Left 1083155156 11:60818315-60818337 CCCACAATAGCATCACCCACCAG No data
Right 1083155158 11:60818328-60818350 CACCCACCAGCTTTTCCTGATGG No data
1083155149_1083155158 27 Left 1083155149 11:60818278-60818300 CCTTCTGCCAACTCTATCACCTG No data
Right 1083155158 11:60818328-60818350 CACCCACCAGCTTTTCCTGATGG No data
1083155153_1083155158 20 Left 1083155153 11:60818285-60818307 CCAACTCTATCACCTGTAGGGGT No data
Right 1083155158 11:60818328-60818350 CACCCACCAGCTTTTCCTGATGG No data
1083155154_1083155158 8 Left 1083155154 11:60818297-60818319 CCTGTAGGGGTCTCTATCCCCAC No data
Right 1083155158 11:60818328-60818350 CACCCACCAGCTTTTCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083155158 Original CRISPR CACCCACCAGCTTTTCCTGA TGG Intergenic
No off target data available for this crispr