ID: 1083155159

View in Genome Browser
Species Human (GRCh38)
Location 11:60818330-60818352
Sequence AACCATCAGGAAAAGCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083155159_1083155166 7 Left 1083155159 11:60818330-60818352 CCCACCAGCTTTTCCTGATGGTT No data
Right 1083155166 11:60818360-60818382 CCCACTGTCATGGCCCAAACAGG No data
1083155159_1083155163 -3 Left 1083155159 11:60818330-60818352 CCCACCAGCTTTTCCTGATGGTT No data
Right 1083155163 11:60818350-60818372 GTTGCTCTACCCCACTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083155159 Original CRISPR AACCATCAGGAAAAGCTGGT GGG (reversed) Intergenic
No off target data available for this crispr