ID: 1083155160 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:60818331-60818353 |
| Sequence | CAACCATCAGGAAAAGCTGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1083155160_1083155163 | -4 | Left | 1083155160 | 11:60818331-60818353 | CCACCAGCTTTTCCTGATGGTTG | No data | ||
| Right | 1083155163 | 11:60818350-60818372 | GTTGCTCTACCCCACTGTCATGG | No data | ||||
| 1083155160_1083155166 | 6 | Left | 1083155160 | 11:60818331-60818353 | CCACCAGCTTTTCCTGATGGTTG | No data | ||
| Right | 1083155166 | 11:60818360-60818382 | CCCACTGTCATGGCCCAAACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1083155160 | Original CRISPR | CAACCATCAGGAAAAGCTGG TGG (reversed) | Intergenic | ||