ID: 1083155162

View in Genome Browser
Species Human (GRCh38)
Location 11:60818343-60818365
Sequence AGTGGGGTAGAGCAACCATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083155162_1083155166 -6 Left 1083155162 11:60818343-60818365 CCTGATGGTTGCTCTACCCCACT No data
Right 1083155166 11:60818360-60818382 CCCACTGTCATGGCCCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083155162 Original CRISPR AGTGGGGTAGAGCAACCATC AGG (reversed) Intergenic
No off target data available for this crispr