ID: 1083155166

View in Genome Browser
Species Human (GRCh38)
Location 11:60818360-60818382
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083155160_1083155166 6 Left 1083155160 11:60818331-60818353 CCACCAGCTTTTCCTGATGGTTG No data
Right 1083155166 11:60818360-60818382 CCCACTGTCATGGCCCAAACAGG No data
1083155162_1083155166 -6 Left 1083155162 11:60818343-60818365 CCTGATGGTTGCTCTACCCCACT No data
Right 1083155166 11:60818360-60818382 CCCACTGTCATGGCCCAAACAGG No data
1083155155_1083155166 23 Left 1083155155 11:60818314-60818336 CCCCACAATAGCATCACCCACCA No data
Right 1083155166 11:60818360-60818382 CCCACTGTCATGGCCCAAACAGG No data
1083155156_1083155166 22 Left 1083155156 11:60818315-60818337 CCCACAATAGCATCACCCACCAG No data
Right 1083155166 11:60818360-60818382 CCCACTGTCATGGCCCAAACAGG No data
1083155159_1083155166 7 Left 1083155159 11:60818330-60818352 CCCACCAGCTTTTCCTGATGGTT No data
Right 1083155166 11:60818360-60818382 CCCACTGTCATGGCCCAAACAGG No data
1083155157_1083155166 21 Left 1083155157 11:60818316-60818338 CCACAATAGCATCACCCACCAGC No data
Right 1083155166 11:60818360-60818382 CCCACTGTCATGGCCCAAACAGG No data
1083155161_1083155166 3 Left 1083155161 11:60818334-60818356 CCAGCTTTTCCTGATGGTTGCTC No data
Right 1083155166 11:60818360-60818382 CCCACTGTCATGGCCCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083155166 Original CRISPR CCCACTGTCATGGCCCAAAC AGG Intergenic