ID: 1083157815

View in Genome Browser
Species Human (GRCh38)
Location 11:60836117-60836139
Sequence AAGAGGTACAACAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083157815_1083157821 13 Left 1083157815 11:60836117-60836139 CCCTCTTCCCTGTTGTACCTCTT No data
Right 1083157821 11:60836153-60836175 ATAAACATTCAAAAAAGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083157815 Original CRISPR AAGAGGTACAACAGGGAAGA GGG (reversed) Intergenic
No off target data available for this crispr