ID: 1083159324

View in Genome Browser
Species Human (GRCh38)
Location 11:60845079-60845101
Sequence AGGTCTGAGCAGAGGGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 1, 1: 0, 2: 9, 3: 60, 4: 483}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083159318_1083159324 10 Left 1083159318 11:60845046-60845068 CCACAGTGCTCAGAGATGGCCTT 0: 1
1: 0
2: 6
3: 25
4: 318
Right 1083159324 11:60845079-60845101 AGGTCTGAGCAGAGGGAGCCGGG 0: 1
1: 0
2: 9
3: 60
4: 483
1083159320_1083159324 -9 Left 1083159320 11:60845065-60845087 CCTTGCAGATAAACAGGTCTGAG 0: 1
1: 0
2: 1
3: 13
4: 152
Right 1083159324 11:60845079-60845101 AGGTCTGAGCAGAGGGAGCCGGG 0: 1
1: 0
2: 9
3: 60
4: 483

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083159324 Original CRISPR AGGTCTGAGCAGAGGGAGCC GGG Intronic
900008959 1:88779-88801 AGGTCAGAGGAGATGGAGGCTGG - Intergenic
900079414 1:844413-844435 ACATCTGCTCAGAGGGAGCCTGG - Intergenic
900322935 1:2093938-2093960 GGGCCAGGGCAGAGGGAGCCAGG + Intronic
900471688 1:2858138-2858160 GGGTGTGAGCAAAGGGAGCCTGG - Intergenic
900546257 1:3230896-3230918 AGGTGTGAGCAAAGGGAGCAGGG + Intronic
900892391 1:5458728-5458750 AGGTTTGCTCAGAGGGACCCAGG + Intergenic
901123294 1:6912099-6912121 AGGGCTGAGCAGTGTGAGCCTGG + Intronic
901525889 1:9823478-9823500 GGGTCCGAGCGCAGGGAGCCGGG - Intronic
901675472 1:10881143-10881165 AGATCTGAGAAGACGGAGCTGGG - Intergenic
902260399 1:15220916-15220938 AGTTCTCAGCAGAGGGAGATAGG - Intergenic
902798125 1:18812829-18812851 AGATCAGAGCAGAGGGAGACAGG + Intergenic
902987014 1:20161047-20161069 GGGTCTGAGCAGAGAGTGCCAGG + Intergenic
903776520 1:25797565-25797587 GGATTTGAGCAGAGGGACCCGGG - Intergenic
905281996 1:36855199-36855221 AGGTCTGAGTAGTGGGAGCCTGG + Intronic
906147736 1:43569876-43569898 AGGGCTGAGCGGAGGGTACCTGG + Intronic
906942018 1:50263838-50263860 AGGTGTGGGGAGAGGGAGACAGG - Intergenic
907051217 1:51330740-51330762 GTGTCTGCGCAGAGGGCGCCGGG - Intronic
907243029 1:53091081-53091103 AGGTCTGAGCAGCAGGGCCCTGG + Intronic
907486879 1:54784177-54784199 AGGCATGAGCAGAGGGAGGTGGG + Intronic
912524454 1:110270793-110270815 AGGTCTGAACACAGGATGCCTGG + Intronic
912950343 1:114116363-114116385 AGATCTGTGCAGAGAGGGCCCGG - Intronic
914857364 1:151362556-151362578 AGCACAGAGCAGGGGGAGCCTGG - Intergenic
914878539 1:151530133-151530155 AGGGCTGAGCAGAGAGGGCTGGG - Intronic
915143396 1:153780390-153780412 AAGACAGAGCAGTGGGAGCCTGG - Intergenic
915282331 1:154830956-154830978 AGGTCTGGGCAGAGGGGAACTGG + Intronic
915950827 1:160188923-160188945 AGGCCAGAGCAAAGGCAGCCAGG - Intergenic
917894948 1:179478536-179478558 AGGGCACAGCAGAGGGACCCTGG + Intronic
917969453 1:180197557-180197579 AGGTCTGAGGAGCTGGAGGCTGG - Exonic
919085590 1:192917280-192917302 AGATGTGAGCAGAGCGAGGCTGG - Intergenic
919743604 1:200994991-200995013 AGGTCTGAGCACAGCAAGGCAGG + Intronic
919754092 1:201055860-201055882 AGGTCTGTGTAGCGGAAGCCTGG - Intronic
919972314 1:202589253-202589275 AGGTCTGACCCCAGGCAGCCAGG + Exonic
920305409 1:205015290-205015312 GGGTCTGAGCAGTGGGAGTCTGG - Intronic
920646231 1:207806338-207806360 AGGGTGGAGCAGAGGGAGCATGG + Intergenic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
921219190 1:212961270-212961292 AGGTCTGAGCACACCCAGCCAGG + Intronic
921957657 1:221000834-221000856 AGGTCTGACCAGAAGAGGCCAGG + Intergenic
924715176 1:246566494-246566516 AGGGGTGCGCAGAGGGAGGCGGG + Exonic
1062947805 10:1474382-1474404 AGCTCAGAGCAGGGGCAGCCCGG + Intronic
1063462363 10:6222836-6222858 AGGACTGAGCACAGAGGGCCGGG - Exonic
1063811961 10:9721858-9721880 AGACATCAGCAGAGGGAGCCAGG + Intergenic
1065115380 10:22478084-22478106 AGGTCTGCGCATGGAGAGCCCGG - Intergenic
1067256590 10:44647837-44647859 TGGACTTAGCAGAGGGAGCAAGG + Intergenic
1070421218 10:76239129-76239151 AGCCCTGTGCAGAGGGAGCATGG + Intronic
1070596210 10:77834782-77834804 GGGTCTGAGCAGAAGCAGACAGG + Intronic
1070960601 10:80497783-80497805 AGGACTGTGCAGAGGGCTCCAGG - Intronic
1071381547 10:85068161-85068183 AGGTTTGAGGAGAGGGAGAGAGG - Intergenic
1071553669 10:86586149-86586171 GGGTCTTAGCAGAGGGAGTCAGG + Intergenic
1072152774 10:92696498-92696520 ATGGCTGAGCAGAGGGCGCAGGG + Intergenic
1072481903 10:95817261-95817283 AGGTCTGGGCAGACGCATCCAGG - Intronic
1072686054 10:97537616-97537638 AGGTCTGAAAAGAGGGAGGAGGG + Intronic
1073427254 10:103462822-103462844 AGGAGTGAGCAGGTGGAGCCGGG - Intergenic
1073453566 10:103623360-103623382 GGGTCTGAGCAGAGGGTGCAGGG - Intronic
1074234721 10:111573690-111573712 AGATCTAAGCAAAAGGAGCCTGG - Intergenic
1074607287 10:114985844-114985866 AGGTCTGAAGAGAGGGAGAGAGG + Intergenic
1075517100 10:123118043-123118065 AGCTCTGAGCCTGGGGAGCCTGG + Intergenic
1075522019 10:123148726-123148748 AGCTCTGGCCAGAGGGGGCCCGG - Intronic
1076333019 10:129685348-129685370 AGAACTGGCCAGAGGGAGCCAGG - Intronic
1076839424 10:133038746-133038768 GGGTCTGAGCAGTGGGTCCCTGG + Intergenic
1076866341 10:133168139-133168161 AGGTCTGCGGGGAGGGAACCTGG + Intronic
1077116825 11:888979-889001 AAGCCTGAGCAGGGGCAGCCCGG - Intronic
1077300070 11:1842695-1842717 AGATCTGAGCACAGGGACCTTGG - Intergenic
1077332740 11:1990506-1990528 AGCTCTGAGCATATGGACCCAGG - Intergenic
1077368723 11:2171803-2171825 AGGGCTGTGGAGACGGAGCCCGG - Exonic
1077374438 11:2198926-2198948 TGAGCTGAGCAGTGGGAGCCAGG + Intergenic
1077630406 11:3807838-3807860 TGGTCTTTGCAAAGGGAGCCAGG + Intronic
1077888912 11:6405046-6405068 AGGTGTGAGCAGAAGGGGCTGGG - Intronic
1078934909 11:15941706-15941728 GGGCCTCAGCACAGGGAGCCTGG + Intergenic
1079284612 11:19117395-19117417 AGGTCTGGGAAGCGGGAGCCTGG + Intronic
1081626439 11:44658804-44658826 AGGGCTGAGCAGAGGGAGGGAGG + Intergenic
1081674186 11:44958753-44958775 GGGGCTGAGCAGGGGGAGGCAGG + Intergenic
1081688098 11:45056611-45056633 AGGTCTGAGGATGGGGAGCCAGG - Intergenic
1081964872 11:47163426-47163448 AAGGATGGGCAGAGGGAGCCAGG - Intronic
1083159324 11:60845079-60845101 AGGTCTGAGCAGAGGGAGCCGGG + Intronic
1083601652 11:63952405-63952427 AGGTATGAGCAGAGCGAGTGGGG + Exonic
1083619446 11:64041761-64041783 TGGTCAGACCAGAGGGGGCCTGG + Intronic
1083628241 11:64082801-64082823 ATGTCTGAGCTGAGGGAAACAGG - Intronic
1083668031 11:64285843-64285865 GGGGCGGAGCAGCGGGAGCCGGG + Intronic
1083706439 11:64519568-64519590 AGGTGTGAGCTGAGAGAGGCAGG + Intergenic
1083938711 11:65883624-65883646 AGGACAGAGCTGAGGGGGCCAGG - Exonic
1084213600 11:67634975-67634997 AGGTGTGAGCAGCGGGGGCGGGG - Exonic
1084563371 11:69916226-69916248 GGGTCTGGGCAGAGTGAGGCTGG + Intergenic
1084637028 11:70399089-70399111 GGGTCTGAGCGGAGGGGGCCGGG + Intronic
1084650575 11:70486973-70486995 AGGTCTGTGGAGAGGAAGGCCGG + Intronic
1084721261 11:70907028-70907050 AGGGCTGACCAGATAGAGCCAGG + Intronic
1084761482 11:71274802-71274824 AGGCCTGAGGAGAGGGAGAGAGG - Intergenic
1085154096 11:74277434-74277456 ACATCTGAACAGAGGGACCCGGG + Intronic
1085976541 11:81661667-81661689 AGCTCTGAGAAGAGGGAGGGAGG - Intergenic
1086336918 11:85810091-85810113 AGGGATGTGCAGAGGAAGCCCGG - Intronic
1088219061 11:107548130-107548152 AGGGCTGAGCCAAGTGAGCCTGG - Intronic
1088365789 11:109038592-109038614 AGTTGTGAGCAGTGGGAGGCAGG + Intergenic
1088389475 11:109298358-109298380 AGGCCTGAGCAGAGAGAGAGAGG + Intergenic
1088695470 11:112362452-112362474 AGGCCTGAGCAGAGTGTGCGAGG + Intergenic
1088720672 11:112589409-112589431 CTGTCTGAGCAGAGGGGCCCTGG + Intergenic
1088897939 11:114092025-114092047 AGGACTGAGCAGAGGGGCCGAGG + Intronic
1089213442 11:116821370-116821392 TGTCCTGAGCATAGGGAGCCAGG + Exonic
1089747137 11:120625325-120625347 AGGTCAGAGCAAAGGCAGCGGGG + Intronic
1090203822 11:124874168-124874190 TGGTTCGAGCAGTGGGAGCCTGG + Exonic
1090353634 11:126124240-126124262 AGGTATGAGCAGAGGGAGAGAGG - Intergenic
1090356907 11:126146560-126146582 AGGTCTGTGCAGAGGGATGAGGG - Intergenic
1090357263 11:126148242-126148264 AAGTCTGATCAGAGACAGCCTGG + Intergenic
1090800733 11:130170192-130170214 AGGTCTGACCCCAGAGAGCCTGG + Intronic
1091059215 11:132445795-132445817 ACTTCTCAGCAGAGGAAGCCTGG - Intronic
1091150537 11:133324389-133324411 TGGGCTGAGCAGAGGCAGCATGG - Intronic
1091344066 11:134840962-134840984 AGGACTGAGAGGAGGGAGCTTGG - Intergenic
1202815723 11_KI270721v1_random:45682-45704 AGCTCTGAGCATATGGACCCAGG - Intergenic
1091399266 12:172605-172627 AGGGCAGAGGAGAGAGAGCCTGG - Intronic
1091757116 12:3061004-3061026 AGGTGTGAGCACCAGGAGCCAGG - Intergenic
1091817825 12:3453261-3453283 AGGCCTGTGTAAAGGGAGCCAGG - Intronic
1092086696 12:5768615-5768637 AGGGCTGAGGAGAGGGGCCCAGG - Intronic
1092118623 12:6027517-6027539 GGGTCTGATCAGAGGGAGGCAGG + Intronic
1092486590 12:8907577-8907599 GGGCCTGAGCAGAGGGACTCAGG + Intergenic
1092950648 12:13499989-13500011 AGAGATGAGCAGAGGGAGTCTGG + Intergenic
1096193517 12:49634605-49634627 AGGCCTGGGCAGAGGGAGCCAGG + Intronic
1096194053 12:49637594-49637616 AGGCCAGAGAAGGGGGAGCCTGG - Exonic
1096390978 12:51228927-51228949 AGACCTGAGGACAGGGAGCCAGG - Intergenic
1096496425 12:52041854-52041876 AGGGCCCAGCAGAAGGAGCCAGG - Exonic
1096777516 12:53973397-53973419 AGATCTGACGAGAGGGGGCCTGG - Exonic
1097180125 12:57167052-57167074 AGGGATGGGCAGAGGGAGTCAGG + Intronic
1097233870 12:57527061-57527083 AGGGATCTGCAGAGGGAGCCGGG + Exonic
1097471390 12:59997459-59997481 AGGCCTGAGGAGAGGGAGTATGG - Intergenic
1101685034 12:107010881-107010903 AGGCCTGAGGAGAGGGAGAGAGG - Intronic
1101997035 12:109532994-109533016 TGGTGCGAACAGAGGGAGCCCGG - Intronic
1103512351 12:121484105-121484127 AGGTGGGAGGAGAGGGAGGCGGG - Intronic
1103612553 12:122133011-122133033 ATTACTGAGCAGAGGCAGCCTGG - Intronic
1104110655 12:125701022-125701044 GGGTCTGGGAAGAGGGAGACTGG + Intergenic
1104414807 12:128589340-128589362 AGGTCTGGGCGGAGGGATGCAGG - Intronic
1104572288 12:129935645-129935667 GGGTTTGAGGAGAGGGAGACAGG - Intergenic
1104597685 12:130131311-130131333 AGCTCTGGGCAGAGGTATCCAGG - Intergenic
1104657119 12:130581580-130581602 AGGCCTGAGCCGCGAGAGCCTGG - Intronic
1105007131 12:132728592-132728614 TGGCCTGAGCAGATGGAACCAGG + Intronic
1105284227 13:18991698-18991720 GGGTTTGAGCAGAGGGAGGTGGG - Intergenic
1105708106 13:22981365-22981387 AGGTCTGAGCAGAGGGTCCCTGG + Intergenic
1107068440 13:36243137-36243159 AGGTTTGGGCAGAGGGAGTAGGG - Intronic
1107999562 13:45893898-45893920 GGGTGTGAGCAGTGGGAGCTTGG - Intergenic
1109784597 13:67156865-67156887 AGGTCTGAGCAGTGGGGCACTGG + Intronic
1109870390 13:68324750-68324772 AGGCCTGAGGAGAGGGAGAGAGG + Intergenic
1110597771 13:77337966-77337988 AGTTCTGATAAGAGGGAGGCAGG + Intergenic
1111267656 13:85838881-85838903 AGGTTTGAGCCTAGGGAACCTGG + Intergenic
1111589338 13:90323394-90323416 AGGTTTGAGGAGTGGGAGGCAGG + Intergenic
1112078267 13:95936632-95936654 AGTTCTCTGCAGAGGGAGCGGGG + Intronic
1112608198 13:100928810-100928832 AGGTCTGAGCCACGGGAGCCAGG - Intergenic
1112999011 13:105610456-105610478 AGGTGTGAGAAGAGGGTGTCGGG - Intergenic
1113499282 13:110760500-110760522 ACGTCTGGGGAGAGGCAGCCTGG + Intergenic
1113713068 13:112483616-112483638 AGGGCTGAGAAGAGGGAGAGAGG + Intergenic
1113794252 13:113047801-113047823 AGGTGTGAGCAGAGGGGACGGGG - Intronic
1113853024 13:113428754-113428776 AGGTCAGGGCAGAGGCAGACTGG + Intronic
1113885961 13:113658508-113658530 AGGTCAGAGCAGAGCCGGCCTGG + Intergenic
1114067164 14:19071048-19071070 AGCTCGGAGCAGATGGAGCTTGG + Intergenic
1114095098 14:19328980-19329002 AGCTCGGAGCAGATGGAGCTTGG - Intergenic
1117375576 14:55115609-55115631 AGGCCTGAGCAGTGAGTGCCTGG + Intergenic
1118259396 14:64233389-64233411 GGCTCTGAGCAAAGAGAGCCGGG - Intronic
1118570128 14:67186562-67186584 AGGTCAGACCCGATGGAGCCAGG + Intergenic
1118815855 14:69313416-69313438 GGGTCTGAGCAGAGACTGCCTGG + Intronic
1118989669 14:70786368-70786390 ATCTCTAAGCACAGGGAGCCAGG + Intronic
1119429613 14:74557913-74557935 AGGCCTGAGCAGAGGCTTCCAGG - Intronic
1119556381 14:75556434-75556456 AGGGCTGAGCAGAATGAGCAAGG - Intergenic
1119990799 14:79195124-79195146 TGCTCTGAGGAGAGGAAGCCAGG - Intronic
1120707115 14:87756541-87756563 AAAACTGAGCAGAGGGATCCAGG + Intergenic
1121448339 14:93992539-93992561 TGCTCTGACCAGAGGGAACCAGG - Intergenic
1121599179 14:95190510-95190532 AGGAGAGAGCAGAGGGAGCCTGG + Exonic
1121642797 14:95497090-95497112 AGGGCTGGGCTGAGGGGGCCTGG + Intergenic
1121722454 14:96119352-96119374 AGTTCTGAGAAGTGGCAGCCTGG + Intergenic
1122047904 14:99036399-99036421 AGGTCTGAGCCAGGAGAGCCTGG - Intergenic
1122221496 14:100241457-100241479 AGGCCTGAGCAAAGGGATCTAGG + Intronic
1124172806 15:27391570-27391592 AGATCTGATCAGTGGCAGCCAGG - Intronic
1124345020 15:28916483-28916505 AGGTGGGAGCAGAGGGGGCCTGG - Intronic
1124560432 15:30768986-30769008 AGGCCTGAGGAGAGGGAGACCGG + Intronic
1124670779 15:31636455-31636477 AGGCCTGAGGAGAGGGAGACAGG - Intronic
1124962432 15:34409025-34409047 AGGTGGGAGCAGAGGGGGCCTGG - Intronic
1124979056 15:34555247-34555269 AGGTGGGAGCAGAGGGGGCCTGG - Intronic
1125822751 15:42646940-42646962 AGGCCTGAGTAGAGGGAGAAAGG + Intronic
1126437254 15:48648047-48648069 GGATCTGAGCAGAGGGACCATGG + Intergenic
1127409372 15:58690634-58690656 AGATATCAGCAGAGAGAGCCAGG + Intronic
1127545789 15:59993598-59993620 AGGTCTGAGAACCGGGATCCTGG + Intergenic
1127639447 15:60901988-60902010 AGGTGTGAGCTGAGGCACCCTGG - Intronic
1128065618 15:64762818-64762840 AGCTCTGAGCAGATGGAGGATGG - Intronic
1128087354 15:64895212-64895234 GAGTCTGTGCAGAGGGTGCCTGG - Intronic
1129182641 15:73886863-73886885 TGGCCTGTGCAGTGGGAGCCTGG + Intronic
1129344790 15:74910291-74910313 AGGTCTGAGTAGTAGGAGCAAGG - Intergenic
1129661291 15:77554440-77554462 AGGGCAGAGGAGAGGGACCCAGG + Intergenic
1129845984 15:78767951-78767973 GGGGAGGAGCAGAGGGAGCCGGG - Intronic
1130090647 15:80818262-80818284 AGGGCAGAGGAGAGGGAGCATGG + Intronic
1130255891 15:82325912-82325934 AGGGAGGAGCAGAGGGAGCTGGG + Intergenic
1130546080 15:84858250-84858272 AGGTCAGAGCAGCAGGAGACGGG + Exonic
1130599069 15:85264074-85264096 GGGGAGGAGCAGAGGGAGCCGGG - Intergenic
1130957901 15:88639911-88639933 AGGTCTCACCAGTGGCAGCCTGG - Intronic
1131174392 15:90201114-90201136 GGGTCTGAGCAGTGGGGGCGGGG + Intronic
1132240943 15:100256657-100256679 AGGTCTGGCCAGAGGGATCCTGG + Intronic
1132614085 16:831784-831806 AGCTCTGACCAGCGGGTGCCTGG + Intergenic
1132976786 16:2715180-2715202 AGGTGTGAGGTGAGGGGGCCTGG + Intronic
1133022364 16:2972413-2972435 GTCTCTGGGCAGAGGGAGCCAGG - Exonic
1133098098 16:3461259-3461281 GGGTCTGAACCGGGGGAGCCAGG + Intronic
1133285491 16:4688769-4688791 AGGTGGGAGCAGAGGGAGGAGGG - Intronic
1133379827 16:5320782-5320804 TGGTCTGAGTAGAGAGAGCTGGG + Intergenic
1133809827 16:9152826-9152848 AGGGGTGAGCAGAGGGAGGTGGG - Intergenic
1135110955 16:19690523-19690545 AGGTTTGAGGAGAGGGTGACAGG + Intronic
1135241691 16:20812652-20812674 AGGTATGAGGAGAGGGAAGCAGG - Intronic
1136091132 16:27920815-27920837 AGGGCTGAGCAGAGGCAACCAGG + Intronic
1136296901 16:29309002-29309024 AGGGATGGGCAGAGGGAGCACGG - Intergenic
1136454299 16:30371596-30371618 AGGTCTGAGGAACTGGAGCCTGG - Intronic
1136683015 16:31978820-31978842 AGGTTTGGGGAGAGGAAGCCAGG + Intergenic
1137682535 16:50362773-50362795 AGGTCTGAGGAGAGGGAGAAAGG + Intronic
1138111705 16:54329391-54329413 AGTTCTGAGCAGCTGGAGTCTGG - Intergenic
1138342958 16:56302683-56302705 CCTTCTGAGAAGAGGGAGCCCGG - Intronic
1138647864 16:58438336-58438358 AGGGCTGTGCACAGGGAGTCTGG - Intergenic
1139217753 16:65145708-65145730 ACTTCTGAGCAGAAGCAGCCTGG - Intergenic
1140028246 16:71311576-71311598 GCGGCTGAGCAGAGGGAGCAAGG + Intergenic
1140028503 16:71313784-71313806 AGCTCTGACAAGAAGGAGCCAGG - Intergenic
1141760529 16:86025969-86025991 AGGACTGAGCTGTAGGAGCCAGG + Intergenic
1141896302 16:86960839-86960861 AGGTCAGAGCCGAGCGAGCCTGG - Intergenic
1142147692 16:88499433-88499455 AGGCCAGGGCAGAGGAAGCCGGG + Intronic
1142227864 16:88886198-88886220 AGGTCCGAGCAGAGGGGGCCTGG + Intronic
1142494428 17:298887-298909 AGGTCGGGGCCGGGGGAGCCAGG + Intronic
1142505170 17:358577-358599 AGGTGTGAGCGGAGTGAGTCGGG + Intronic
1143030293 17:3963926-3963948 AGGACCGCGCAGAGGGTGCCAGG + Intronic
1143118610 17:4594050-4594072 AGGTCTGAGCAGGGGGAGTGAGG + Intronic
1143453093 17:7048309-7048331 AGGCATGGGCAGAGGTAGCCAGG - Intergenic
1143761030 17:9104522-9104544 AGGGCAGAGCAGAGGGGGTCTGG + Intronic
1143954823 17:10660008-10660030 AGGTCGGAGCAGGAGGAGCATGG + Intergenic
1145711592 17:26983344-26983366 GCGGCTGAGCAGAAGGAGCCAGG + Intergenic
1145980409 17:29007818-29007840 AGGGGTGAGGAGAGGAAGCCAGG + Intronic
1146115498 17:30134125-30134147 AGGCCTGAGGAGAGGGAGAGAGG + Intronic
1146268396 17:31468249-31468271 GGGTCTGAGCAGAGGAAGCGAGG - Intronic
1146289209 17:31596155-31596177 AGGGCAGGGCAGAGGGAGCCTGG - Intergenic
1146822746 17:35997894-35997916 AGGTGTGGGCAGATGGAGACAGG + Intronic
1146913446 17:36662980-36663002 AGGTATGGGCAGAGAGACCCTGG + Intergenic
1146913558 17:36663784-36663806 AGGTCTGACTAGTGAGAGCCAGG - Intergenic
1146915614 17:36676514-36676536 AGGTCTGAGCAGAGTGCTCCTGG - Intergenic
1147318679 17:39633175-39633197 AGGTCACCGCAGAGGGAGCTGGG + Intronic
1147960884 17:44166998-44167020 AGGACTGAGCAGGGGGACCGGGG - Intergenic
1149195640 17:54116848-54116870 GGGTCAGAGCAGAGGCAGCAAGG - Intergenic
1149630363 17:58116817-58116839 AGGTCTGGGGAGATGGAGCATGG - Intergenic
1150119442 17:62587634-62587656 AGGGCTTAGCAGAGGGAGAAGGG + Intronic
1150250740 17:63703128-63703150 AGGTCTGAGGGAAGGGAGGCAGG + Exonic
1150624346 17:66832104-66832126 AGGTCTGTGATCAGGGAGCCTGG - Intergenic
1150647205 17:66986342-66986364 AGGACGGAGCGGAGGGAGCAAGG + Intronic
1150776416 17:68085296-68085318 AGGTGGTTGCAGAGGGAGCCTGG - Intergenic
1152367256 17:79863424-79863446 AGGTCTGAGCTGAGCATGCCGGG + Intergenic
1152610070 17:81311070-81311092 GGGTCTCAGCAGGGGGAGGCCGG - Intergenic
1152757275 17:82092288-82092310 AGGTCTGAGCAGAGGCACTGAGG - Intronic
1153016093 18:583892-583914 AGGACTGGGCAGAGAGAGGCTGG + Intergenic
1153531912 18:6055318-6055340 AGGTCTGAGCAAAGTGAACATGG - Intronic
1153773321 18:8432771-8432793 AGGGCTGAGCAGAGGCTGCTGGG - Intergenic
1154009916 18:10565575-10565597 GGGGCGGGGCAGAGGGAGCCAGG - Intergenic
1155602839 18:27569131-27569153 GGAGCTGAGCAGAGGCAGCCGGG + Intergenic
1156556576 18:38075251-38075273 AGGTCTGAGCAGAGGAAGATGGG - Intergenic
1157050566 18:44159017-44159039 ATGTCTGAGAAGCTGGAGCCAGG + Intergenic
1157815211 18:50725134-50725156 AGTTCTGGGCAGTGGGAACCTGG - Intronic
1160659727 19:292278-292300 AGCCCTGAGCTGAGGGTGCCTGG + Intergenic
1161083277 19:2321979-2322001 GGGTCTCAGCCGTGGGAGCCGGG - Intronic
1161170582 19:2810577-2810599 AGCTCTGGGCAGAGTGGGCCGGG + Intronic
1161286541 19:3471307-3471329 AGGTCAGAGGGGAGGGAGGCTGG + Intergenic
1161455943 19:4369763-4369785 GGAGCTGAGCAGAGGGACCCGGG - Intronic
1163032933 19:14556149-14556171 TGGCCTGAGCAGAGTGAGTCAGG - Intronic
1163236133 19:16031663-16031685 GGGTCTGATCAGTGGGAACCTGG + Intergenic
1163268145 19:16233771-16233793 AGGGCTGAGCAGAGGCAGCCTGG - Intronic
1163386697 19:17004438-17004460 AGGTACGGGAAGAGGGAGCCAGG + Intronic
1163496490 19:17648990-17649012 AGGTCACAGAAGAGGGAGTCGGG + Intronic
1163784261 19:19266549-19266571 AGGTGAGAGCATAGGCAGCCAGG + Exonic
1164590373 19:29503612-29503634 GGGACGGAGCAGAGGGAGCTGGG - Intergenic
1165044213 19:33091904-33091926 AAGACTGAGAAGAGAGAGCCTGG - Intronic
1165062917 19:33213646-33213668 AGGTCTGGGGACAGGGACCCTGG - Intronic
1165242616 19:34480781-34480803 ATCTCTGAGCAGAGAGGGCCTGG + Intergenic
1165316053 19:35055992-35056014 AGGCCAGAGCAGAGTGAGCCAGG - Intronic
1165363687 19:35351491-35351513 AGATCTGAGGACAGGGAGCCAGG + Intergenic
1165838848 19:38774831-38774853 AGGCCTGGGCAGAGGCAGGCTGG + Intergenic
1165840607 19:38787309-38787331 AGGCCTGGGCAGAGGCAGGCTGG - Intergenic
1165860511 19:38906956-38906978 GGGTCTGTGGACAGGGAGCCTGG - Intronic
1166271392 19:41716434-41716456 AGGTGTGTGGAGAAGGAGCCCGG + Intronic
1166503127 19:43355434-43355456 AGGTCTGGGTAGAGGCACCCAGG - Intronic
1166507327 19:43379324-43379346 AGGTCTGGGTAGAGGCACCCAGG + Intergenic
1167203774 19:48086229-48086251 AGTTCTGAGCACAGGCTGCCTGG + Intronic
1167713067 19:51124289-51124311 AGGACTGAGCAGAGGGACATGGG - Intergenic
1167721670 19:51184132-51184154 AGGACTGAGCAGAGGGATGCGGG - Intergenic
1167762656 19:51459065-51459087 AGGCCTGAGCAGAGGGACACGGG + Intergenic
1167769056 19:51502372-51502394 AGGACTGAGCAGAGAGACACGGG + Intergenic
1167794007 19:51697366-51697388 AGGTCTGAGCAGAGTGGGGTGGG + Intergenic
1167851332 19:52204680-52204702 AACTGTGTGCAGAGGGAGCCAGG + Intronic
1168107312 19:54172850-54172872 GGGTCTGAGGAGGAGGAGCCTGG - Intronic
1168148862 19:54434417-54434439 AGGGCTGTGCAGAGGAAGCTGGG - Intronic
1168311982 19:55465068-55465090 TGGGCTGAGCAGAGGGAGGGAGG - Intergenic
1168349823 19:55669378-55669400 AGGCTTGAGCAGAGGGAGACTGG + Intronic
1168584773 19:57583590-57583612 AGGTCAGAGCAGGAGCAGCCGGG + Intronic
925030257 2:645039-645061 CGGTCTGGACAGATGGAGCCTGG + Intergenic
925356165 2:3242942-3242964 AGATTTGATCAAAGGGAGCCTGG - Intronic
925606638 2:5666945-5666967 AGGGCTGAGCAGGGGGAGGAGGG - Intergenic
925913482 2:8588087-8588109 GGGCCTGAGCAGAGGAGGCCAGG - Intergenic
925913497 2:8588137-8588159 GGGCCTGAGCAGAGGAGGCCAGG - Intergenic
927809267 2:26172882-26172904 GGGTCCGAGGAGAGGGGGCCGGG + Intergenic
928389410 2:30897688-30897710 AGGGCTCAGCAGAGGAGGCCGGG + Intergenic
928660071 2:33492946-33492968 AAGCCTGGGCAGAGCGAGCCAGG - Intronic
929672856 2:43891638-43891660 AGGCCTGAGTAGAGGAAGACAGG - Intronic
930521986 2:52479279-52479301 AAGTCTGAGATCAGGGAGCCAGG + Intergenic
932125235 2:69139295-69139317 AGCTCAGAGCAGAGGGAGTTAGG - Intronic
932505731 2:72229526-72229548 AGGTATTATCAGAGGGAGACAGG + Intronic
933290564 2:80433603-80433625 AGCTGTGAGCAGAGGCAACCAGG - Intronic
933677081 2:85066489-85066511 AGCTCTGAGCACACTGAGCCAGG + Intergenic
933727364 2:85434438-85434460 AGGTCTGATCAGAAGAGGCCGGG - Intronic
933950726 2:87326983-87327005 GGGCCTGGGCAGAGGGATCCAGG - Intergenic
936061613 2:109298651-109298673 AGGCCTGGCCAGAGGGAGCACGG - Intronic
936151633 2:110025136-110025158 GGGTCTGGGCAGTGGTAGCCAGG + Intergenic
936193041 2:110346233-110346255 GGGTCTGGGCAGTGGTAGCCAGG - Intergenic
936245216 2:110820539-110820561 AGGTCTGAGGAGAGGGAGTGGGG + Intronic
936329052 2:111531595-111531617 GGGCCTGGGCAGAGGGATCCAGG + Intergenic
936976000 2:118223545-118223567 AGGTTTGGGAAGAGGGAGCGTGG - Intergenic
937069722 2:119053896-119053918 GGGCCTGAGGAGAGGGGGCCTGG - Intergenic
938484556 2:131691125-131691147 AGCTCGGAGCAGATGGAGCTTGG + Intergenic
938716613 2:134027675-134027697 AGTTCTGGGGAGAGGGAGCTGGG + Intergenic
940223462 2:151377873-151377895 AGGTTTGAGCACAGGCAGTCTGG - Intronic
940726076 2:157338022-157338044 AAGTCTGTGCAGAAGGAGCATGG - Intergenic
941159092 2:162015613-162015635 AGGTCAGGGAGGAGGGAGCCGGG - Intronic
946043691 2:216803776-216803798 AGGTGTGAACATAGAGAGCCAGG - Intergenic
948411051 2:237761138-237761160 AGGCCTGAGAAGATGGGGCCTGG - Intronic
948556650 2:238816189-238816211 AGATCTGACCAGAGGGACCAAGG - Intergenic
948613182 2:239182310-239182332 AGCTCTGAGCAGCGGGAGGGAGG - Intronic
1168845919 20:944664-944686 AGGCTTGAGCAGAGAGGGCCTGG - Intergenic
1168950695 20:1799524-1799546 AGGACTGAGAAGAAGGAGACAGG + Intergenic
1169003975 20:2191719-2191741 AGGTGTGAGCACACGGCGCCCGG + Intergenic
1169236064 20:3930866-3930888 AGGTCTGAGCTGAGGGATACAGG - Intronic
1169379815 20:5096632-5096654 TGGCCTGGGCAGAGGGTGCCAGG + Intronic
1171031163 20:21677525-21677547 AGGTCTGAGCCCAGGGAGTTTGG + Intergenic
1172844652 20:37922686-37922708 AGGGCTGTGCAGAGGGAGACAGG + Intronic
1173942076 20:46919952-46919974 AGGCCTGAGCAGAGGGAGAGAGG + Intronic
1174110380 20:48194326-48194348 GGGTCTCAGCAGAGGGGCCCAGG + Intergenic
1174171409 20:48620186-48620208 GGGTCTCAGCAGAGGGGCCCAGG - Intergenic
1174728424 20:52889567-52889589 AGGTCTGAGCAGCAGCAGCATGG + Intergenic
1175220245 20:57412514-57412536 AGGGCAGAGCAGAGCAAGCCAGG - Intergenic
1175692473 20:61075525-61075547 AGCTGTGTGGAGAGGGAGCCAGG - Intergenic
1175914839 20:62420994-62421016 AGGGCTGGGCGGAGTGAGCCTGG + Intronic
1175938537 20:62526453-62526475 GGGTCTGCGGAGAGGTAGCCGGG + Intergenic
1175985613 20:62762922-62762944 GGCTGTGAGCAGAGGGATCCCGG - Intergenic
1176082908 20:63282931-63282953 TGGCCTGAGAAGAGGGAACCAGG - Intronic
1178678341 21:34649741-34649763 TGGTTAGAGCAGAGGGAGCCAGG + Intergenic
1178954575 21:37010741-37010763 AGGGCTAAGAAGTGGGAGCCTGG - Intronic
1179404100 21:41111200-41111222 GGGTTTAAGCAGAGGGAGGCAGG + Intergenic
1179766794 21:43580047-43580069 AGGCCTGAGCAGAGGGATGTAGG - Intronic
1179780186 21:43694633-43694655 AGGCCTGAGCAGAGCGTGGCTGG - Exonic
1180205256 21:46255773-46255795 AGGTCTGGGCTGAGGGGGCAGGG + Intronic
1180485641 22:15793615-15793637 AGCTCGGAGCAGATGGAGCTTGG + Intergenic
1180945988 22:19693804-19693826 AGGCCTGAGCGGAGGCAGCAGGG + Intergenic
1181319263 22:21991909-21991931 AGGTCTGTTGAGAGAGAGCCAGG - Intergenic
1181372984 22:22432533-22432555 AGGCCTGAGCAGCAGCAGCCGGG - Intergenic
1181514893 22:23404772-23404794 AGGTCTGTGCAGTGGGAGCAAGG + Intergenic
1181516715 22:23418300-23418322 GGAGCAGAGCAGAGGGAGCCGGG - Intergenic
1182425424 22:30269048-30269070 AGATCTGAGCAGAGGGGTCTAGG + Intergenic
1182893930 22:33843487-33843509 AGGTCTCAACAGAGGTAGACAGG + Intronic
1183037084 22:35148665-35148687 AGGTCTGTGAACAGGAAGCCTGG + Intergenic
1183084985 22:35481163-35481185 AGGTGAGGGCAGAGGGAGGCAGG + Intergenic
1183173310 22:36203974-36203996 AGGTCTGAACAGAGGGACAGAGG + Intronic
1183178052 22:36238785-36238807 AGGTCTGAACAGAGGGACAGAGG + Intronic
1183265277 22:36821067-36821089 ATGGCTGAGCTCAGGGAGCCGGG + Intergenic
1183511953 22:38241118-38241140 ACAGCTGAGCAGCGGGAGCCTGG + Intronic
1183727070 22:39596106-39596128 AGGTCAGAGCAGAGTGAGCCAGG + Intronic
1183730301 22:39614734-39614756 AGGTCGGAGTAGAGGGTGCTGGG + Intronic
1183748836 22:39707635-39707657 AAGCCTGAGCAGGGGGTGCCTGG - Intergenic
1184035449 22:41915681-41915703 AGGTGTGAGGAGAGGGGGACTGG + Intergenic
1184241439 22:43213024-43213046 AGGCCAGAGCAGAGGGAGGCGGG + Intronic
1184302817 22:43572545-43572567 AGGTCTAAGGAGATGGGGCCAGG - Intronic
1184504189 22:44891189-44891211 AGGTCAGACCAGTGGGAGGCGGG + Intronic
1184515495 22:44959526-44959548 AGGTCAGAGCCGGGGCAGCCAGG - Intronic
1184812359 22:46844762-46844784 CGGTCTGAGCACAGTGAGGCTGG + Intronic
1184878421 22:47289843-47289865 GGGTCTGGCCAGAGGTAGCCAGG - Intergenic
1185042185 22:48510715-48510737 AGCTCAGAGCACAGGGAGCATGG - Intronic
1185117369 22:48945407-48945429 AGGTCTGAGCAGGTGGAGCAGGG + Intergenic
1185168270 22:49275695-49275717 AGGCCTGAGCACAGGGAACATGG - Intergenic
1185184591 22:49391456-49391478 TGGGCTGAGTTGAGGGAGCCTGG - Intergenic
1185203316 22:49521851-49521873 AGCTCTGAGCAGATGGAGTCAGG + Intronic
950103973 3:10376838-10376860 AGGTTTGAGCAGAGGAGGGCAGG + Intronic
950232881 3:11292063-11292085 AGGTGTGAGATGATGGAGCCTGG + Intronic
950426615 3:12927901-12927923 AGGGTTGAGCACAGGGACCCTGG + Intronic
950431400 3:12953122-12953144 AGGTCTGAACTGAGCAAGCCAGG + Intronic
950451954 3:13070492-13070514 AGGTCTGAGCAGCAGGTGCTGGG + Intronic
950536967 3:13584395-13584417 AGGTCTGGGCAGAGAGAGCCTGG - Intronic
951744404 3:25961290-25961312 AGCTCAGAACAGACGGAGCCAGG + Intergenic
952144661 3:30518726-30518748 AGTTCTGAGCAGAGAGATGCTGG - Intergenic
953157303 3:40386875-40386897 AAGTCGGAGAGGAGGGAGCCAGG - Intergenic
953435275 3:42872845-42872867 TGTTCTGAGCAGAGAGAGCAGGG + Exonic
953996092 3:47521180-47521202 CGGTCTCAGCAGAGGCAGCAGGG + Intergenic
954715952 3:52527063-52527085 ACTACTCAGCAGAGGGAGCCTGG - Intronic
955239532 3:57166707-57166729 AGTTCTGTGCAGCAGGAGCCAGG - Intronic
956936113 3:74103640-74103662 AGACATTAGCAGAGGGAGCCAGG - Intergenic
960543126 3:118882505-118882527 AGTGCTGAGCAGAGGAACCCAGG - Intergenic
961105735 3:124239691-124239713 AGGTGTAAGCAGAGAGAACCAGG + Intronic
961490445 3:127253712-127253734 AGGGCTGAGGAGAGTGGGCCAGG - Intergenic
961516760 3:127442807-127442829 AGGTGCGAGGAGATGGAGCCAGG - Intergenic
962010208 3:131384215-131384237 AAGTTTGGGCAGAGGGAACCAGG + Intronic
962826230 3:139102728-139102750 TTGCCTGAGCAGAGGGAGCAAGG + Intronic
963606153 3:147413111-147413133 AGGTCTGGGAAGAGGGAGACTGG - Intronic
966914898 3:184579214-184579236 AGGTCGGGGCAGTGGGAACCAGG + Intronic
967405336 3:189109444-189109466 AGGTGGGAGCAGAGGTTGCCAGG - Intronic
967990509 3:195126804-195126826 AGGTCAGAGCAGAGGGCCCCTGG - Intronic
968091466 3:195900836-195900858 AGGGCTGGGCAGAGGCTGCCCGG + Intronic
968569780 4:1333586-1333608 AGGTCTGAGCACAGGGTGCCTGG - Intronic
968952352 4:3701656-3701678 GGGCCTGAGAAGAGGAAGCCAGG + Intergenic
968969444 4:3785950-3785972 AGGGCTGAGGAGGGGCAGCCAGG + Intergenic
969226081 4:5799173-5799195 ATGTCTCAGCAGAGGCGGCCAGG - Intronic
969498732 4:7540544-7540566 CGTTCTGAGCAGCGAGAGCCAGG + Intronic
969574840 4:8030721-8030743 AGGGCTGTGCAGAGGACGCCCGG - Intronic
969600148 4:8171383-8171405 GGGGCTGGGGAGAGGGAGCCAGG - Intergenic
969630436 4:8332808-8332830 AGGTGTGGGGTGAGGGAGCCAGG - Intergenic
970518329 4:16857582-16857604 TGCTCGGAGCAGAGTGAGCCAGG - Intronic
970653396 4:18202708-18202730 AGGTCTCAGCAAATGCAGCCAGG + Intergenic
972209777 4:36823328-36823350 AGTTCTGAGCACAGGCTGCCTGG + Intergenic
972364858 4:38364880-38364902 AGGGGAGAGCAGAGAGAGCCTGG - Intergenic
972675534 4:41256855-41256877 AGGCCTGTGCAGGGGGAGCAGGG - Exonic
972794370 4:42400547-42400569 CAGTCTAAGCAAAGGGAGCCAGG - Intronic
974282023 4:59807482-59807504 AGTTCTGAGCACAGGCTGCCTGG + Intergenic
977674877 4:99735946-99735968 GGCTCTGAGTAGAAGGAGCCTGG + Intergenic
977920880 4:102641259-102641281 AGGCCTGAGCACAGGAAGCCGGG + Intronic
980691457 4:136300194-136300216 CATTCTGAGCATAGGGAGCCTGG + Intergenic
981065628 4:140481765-140481787 AGATCTGAGCAGTGGTTGCCAGG + Intronic
981550492 4:145937380-145937402 CAGTCGGAGCAGACGGAGCCGGG - Intronic
983996956 4:174193712-174193734 AGCTCTGAGCTGAGGGAAACAGG + Intergenic
984490685 4:180431072-180431094 AGGCCTGAGCACAGGGAGTAAGG - Intergenic
984527566 4:180875494-180875516 ATGACTTAGCAGAGGCAGCCAGG - Intergenic
985425759 4:189828653-189828675 ATGGCAGGGCAGAGGGAGCCTGG - Intergenic
986065384 5:4229612-4229634 AGGTCAGAGCAGAAGGAGGTGGG - Intergenic
986284059 5:6347154-6347176 AGGAATGAGGAGAGGGAACCTGG - Intergenic
986736147 5:10668805-10668827 ATGACTGAACAGAAGGAGCCTGG - Intergenic
987058640 5:14220348-14220370 AGGCCTGAGGAGAGGGAGAGAGG - Intronic
989200335 5:38756820-38756842 AAGTCTGAGATCAGGGAGCCGGG - Intergenic
990277601 5:54214852-54214874 AGGTATGATCAAAGGCAGCCTGG + Intronic
991116168 5:62957981-62958003 TGGTTGGAGTAGAGGGAGCCAGG + Intergenic
992267683 5:75034400-75034422 AGGTCTGACCAGAGTCAGCTGGG + Intergenic
993168252 5:84384118-84384140 AAGTCTGAGCAGAGTGCGCGGGG - Intronic
994551500 5:101240036-101240058 AGTTCTGTGCACAGGCAGCCTGG - Intergenic
995538058 5:113157234-113157256 AGGTCAGAGGAGATGGTGCCTGG - Intronic
995855140 5:116584006-116584028 AGGTCTGAGCAGACGGAAGGAGG - Intergenic
997409604 5:133681028-133681050 TGGACAGAGCAGAGGCAGCCAGG + Intergenic
998140894 5:139698822-139698844 AGCTGGGAGCAGAGGGAGCAGGG - Intergenic
998367141 5:141638878-141638900 AGGTTGGAGAAGAGGGAGCAAGG - Intronic
998964631 5:147525712-147525734 AGTTCTGAGCTAAGGGATCCAGG - Intergenic
999586230 5:153092688-153092710 CTGTGAGAGCAGAGGGAGCCAGG - Intergenic
1001091345 5:168743530-168743552 AGGTCCGAGGAGAGGGAGACAGG - Intronic
1001383211 5:171317427-171317449 AAGTCTAGGCAGATGGAGCCAGG - Intergenic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1002030262 5:176423401-176423423 AGTACTGAGAAGAGGGAGCTAGG - Intergenic
1002092471 5:176813355-176813377 GGGTCTGAGAAGGAGGAGCCAGG - Intronic
1002159927 5:177309059-177309081 AAGACACAGCAGAGGGAGCCTGG + Intronic
1002172404 5:177382795-177382817 AAGCCTGAGCAGACGGAGCTTGG + Intronic
1002641438 5:180632407-180632429 AGGCCTGGGCAGGGAGAGCCCGG - Intronic
1002789133 6:424867-424889 AGCTGTCTGCAGAGGGAGCCTGG - Intergenic
1002838070 6:882331-882353 AGGACAGAACAGAGAGAGCCAGG + Intergenic
1003042426 6:2700469-2700491 ATCTGTGACCAGAGGGAGCCTGG - Intronic
1003564804 6:7214076-7214098 ACCTCTGTGCAGAGGAAGCCTGG - Intronic
1003985178 6:11428048-11428070 CGGACTGAGCACAGGGACCCGGG - Intergenic
1005861897 6:29908304-29908326 AGGGCTGGAGAGAGGGAGCCCGG + Intergenic
1006367240 6:33622716-33622738 AGTCCTGAGCTGAGGGTGCCAGG - Intronic
1007224505 6:40303296-40303318 AGCACAGAGCAGAGGGAGCCAGG - Intergenic
1007254728 6:40520752-40520774 AGGCCTGGGCAGAGGGGGACAGG - Intronic
1007424367 6:41737092-41737114 AGTGCAGAGCTGAGGGAGCCAGG + Intronic
1007549204 6:42716129-42716151 TGGTCTGAGCATGGGTAGCCTGG - Intronic
1007750648 6:44068689-44068711 GGGTCTCAGCAGAGGCAGCAGGG + Intergenic
1007776263 6:44226120-44226142 GGGTCAGAGCAGAGCAAGCCTGG - Exonic
1008593567 6:53018262-53018284 AGGGCTGAGCGGAGGAAGCATGG + Intronic
1008757445 6:54814160-54814182 AGGTCTGAGAACAAGAAGCCTGG + Intergenic
1009624917 6:66126813-66126835 AGCTCTGAGCACAGGCTGCCTGG - Intergenic
1011270707 6:85577116-85577138 AGATGTGAGCAGAAGGAGCCAGG + Intronic
1011547686 6:88499222-88499244 GGGTCTGGGCAGAGGGAGCAGGG + Intergenic
1011551860 6:88537543-88537565 AGGACTGAGGAGGGAGAGCCTGG + Intergenic
1012548562 6:100448029-100448051 AGGTGGGAGCCCAGGGAGCCGGG - Intronic
1013364844 6:109429271-109429293 AGGTCTGTGCAGAAGCAGGCTGG - Intronic
1013821387 6:114157211-114157233 AGGTCTCAGCAGTGGGAACAGGG - Intronic
1017708399 6:157145736-157145758 AGGTCTGAGCCCAGGCATCCTGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018466348 6:164049335-164049357 AGGACTGAGCAGAGGCAGCAGGG + Intergenic
1018635204 6:165854560-165854582 AGGGCGGCACAGAGGGAGCCCGG + Intronic
1018668335 6:166160070-166160092 AGCTCACAGCAGAGTGAGCCTGG - Intronic
1018736122 6:166688378-166688400 GGGGATGAGCAGAGGGGGCCGGG - Intronic
1019260824 7:81026-81048 GGGGCTGATCAGAGGGAGGCCGG - Intergenic
1019563438 7:1668788-1668810 AGGTCGGGGCAGAGGGAGAAAGG + Intergenic
1019563668 7:1669696-1669718 AGGGCTGGGCAGAGGAGGCCCGG + Intergenic
1019964848 7:4490500-4490522 AGCTGGGAGCAGAGGGAGGCTGG - Intergenic
1022383849 7:29884279-29884301 AGGTGGGAGCAGAGGGAGCGGGG - Exonic
1023878776 7:44307062-44307084 GGGTCTGAGCAGGGGGAGGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1024509305 7:50190623-50190645 TGGTCGGAGCTGTGGGAGCCAGG - Intergenic
1026837079 7:73646634-73646656 AGGTCTGAGCTGTAGTAGCCAGG - Intergenic
1026989461 7:74575447-74575469 AGTTCTGAGCAGAGGGTAACAGG + Intronic
1027539540 7:79452061-79452083 AGGTTGGAGCTGAGGGAGCCTGG + Intronic
1028672390 7:93418043-93418065 AGGTCTGAGCAATGGGATACAGG - Intergenic
1029305559 7:99617126-99617148 GGGGCTGAGCGGAGGGAGACGGG - Intronic
1029726682 7:102410589-102410611 AGATCTGGGGAGAGGGAGACGGG + Intronic
1030425995 7:109379139-109379161 AGGCCTGAGGAGAGGGAGACAGG - Intergenic
1030514131 7:110519712-110519734 AAGTCAGAGCTGAGTGAGCCTGG - Intergenic
1031991693 7:128202874-128202896 CTGTCTGTGCAGAGGGTGCCAGG + Intergenic
1032519553 7:132533658-132533680 AGCTCTGATCAGTGGAAGCCGGG + Intronic
1033050632 7:138001434-138001456 ATGTCTGAGCAGATGAAGGCGGG - Intronic
1033255562 7:139798389-139798411 TGCTGTGAGCAGAGGAAGCCAGG + Intronic
1033541243 7:142357983-142358005 AAGTGTCTGCAGAGGGAGCCGGG - Intergenic
1034556185 7:151851883-151851905 AGTTCACAGGAGAGGGAGCCGGG + Intronic
1034684406 7:152957370-152957392 TGGTGTGAGCTGAGGCAGCCAGG + Intergenic
1035167957 7:157002819-157002841 AGGTCTACGCAGGGGGACCCCGG - Intronic
1035368527 7:158363703-158363725 AGCTCTGAGGTGAGAGAGCCAGG + Intronic
1036752659 8:11453095-11453117 AGGACAGAGGAGAGGAAGCCTGG - Intronic
1037437551 8:18879287-18879309 AGGTCAGATAAGAGGGAGACAGG + Intronic
1037767016 8:21778321-21778343 AGGGCTGACCAGGGGAAGCCAGG - Intronic
1038715660 8:29988348-29988370 AGTTCAGAGCAGAGGGAGGTGGG - Intergenic
1038926997 8:32151683-32151705 AAATCTGAGCAGGGGGAACCTGG + Intronic
1039719892 8:40151893-40151915 TGGTCAGAGCAGAGTGAGCAGGG - Intergenic
1040554991 8:48470207-48470229 AGGCCACAGCAGAGGCAGCCAGG + Intergenic
1040985245 8:53286855-53286877 ATGACCCAGCAGAGGGAGCCGGG + Intergenic
1042091291 8:65162487-65162509 ACTCCTGATCAGAGGGAGCCTGG + Intergenic
1045254303 8:100506834-100506856 AGGTCTGAGCAGACTGATCCAGG + Intergenic
1045864541 8:106850224-106850246 AGGTCTGAACACAGGATGCCTGG + Intergenic
1046860564 8:119086646-119086668 ATGTCTAACCAGAGGCAGCCGGG - Intronic
1047214579 8:122865962-122865984 AGGAGGGACCAGAGGGAGCCAGG - Intronic
1047342383 8:123994545-123994567 AGTTCTGAGCAGAGACTGCCTGG - Intronic
1047998521 8:130358405-130358427 CGGCATGAGCAGAGGGAGGCGGG - Intronic
1048625371 8:136179358-136179380 AGGTTTGAGGAGTGGGAGCTTGG - Intergenic
1048726312 8:137388924-137388946 TCGTCTGAGCAGAGTGAGCAAGG - Intergenic
1049379552 8:142305229-142305251 AGCTGTGGGCAGAGGGTGCCAGG + Intronic
1049731691 8:144181479-144181501 AGGGCTGAGGAGAGGGTGGCAGG - Intronic
1050793267 9:9502269-9502291 AGGGCTCAGCAGAGGGAGAAAGG - Intronic
1051483651 9:17585621-17585643 AGGTGGGAGCAGAGAGAGCAAGG + Intronic
1053020292 9:34689793-34689815 ATGACCGTGCAGAGGGAGCCCGG - Exonic
1053382131 9:37657864-37657886 AGGTCCAAGCAGAGGGAGGCTGG - Intronic
1053753473 9:41279260-41279282 TGGCAGGAGCAGAGGGAGCCTGG + Intergenic
1054332782 9:63776417-63776439 TGGCAGGAGCAGAGGGAGCCTGG - Intergenic
1054851870 9:69854738-69854760 AGGTGGGAGGAGAGGGAGCTTGG + Intronic
1055072959 9:72186257-72186279 AGATCAGATCAGAGGTAGCCAGG - Intronic
1055505453 9:76943709-76943731 AGCTGTGAGCAGAGGTAGGCAGG - Intergenic
1055534407 9:77223231-77223253 AGGCCCAAGCAGAGGGAGTCAGG - Intronic
1057695897 9:97322939-97322961 AGGCCTGAGAAGAGGAATCCTGG + Intronic
1058523736 9:105837098-105837120 ACATCAGAGCAGAGTGAGCCAGG - Intergenic
1058935718 9:109767639-109767661 ATGTCAGGGCAGAGGGAGCGAGG - Intronic
1059459132 9:114418614-114418636 AGGCCAGAGCAGAGGGAGTACGG - Intronic
1060379396 9:123152723-123152745 ATGGCTGAGCAGAGAGAGGCGGG + Intronic
1061291649 9:129653798-129653820 AGGGCTGAGCAGCGGGAGGCAGG + Intergenic
1061374287 9:130214900-130214922 AGGTCTTTGCAGAGGGAAACTGG - Intronic
1061492888 9:130956064-130956086 AGGGCTGTGCAGAGGAAGCCAGG + Intergenic
1061675034 9:132210788-132210810 ACATCTCAGCAGAGGGAGCGTGG + Intronic
1062212219 9:135371260-135371282 AGGGCTGAGCTGGGGTAGCCCGG - Intergenic
1062245727 9:135565176-135565198 AGAGCGGAGCAGAGGGGGCCGGG + Intronic
1062252573 9:135605677-135605699 GGCTCTGAGCAGAGGGAGCCAGG - Intergenic
1062290440 9:135791980-135792002 AGGGCTGAGCAGGGGCTGCCCGG + Intronic
1062514648 9:136926492-136926514 TGGTCTGAGCAGAGGCGGCGTGG - Exonic
1203767816 EBV:35435-35457 AGGTATGAGCAGGGGGAATCAGG - Intergenic
1186534245 X:10330313-10330335 AGGGCCGAGCAGGGGCAGCCCGG - Intergenic
1187128180 X:16474228-16474250 AGACATCAGCAGAGGGAGCCAGG + Intergenic
1187165655 X:16801857-16801879 AGATCTGAACACAGGGAGTCTGG - Intronic
1187473261 X:19588178-19588200 AGTGAAGAGCAGAGGGAGCCTGG + Intronic
1187492729 X:19767278-19767300 AGGTCTGAAAAGAGCAAGCCAGG + Intronic
1191715800 X:64192709-64192731 GGGGCTGAGCAAAGTGAGCCAGG - Exonic
1197256663 X:124270621-124270643 AGGTCTGGGCAAAGGGAGGGTGG + Intronic
1197722857 X:129756580-129756602 AGGTCTGAGCAGAGACATCCAGG - Intronic
1197863008 X:130990044-130990066 AAGTGTGAGTAGAGGGTGCCGGG - Intergenic
1199708586 X:150451877-150451899 AGGCCTGTGCTGAGGGGGCCCGG - Intronic
1200528010 Y:4297316-4297338 AGTTCTGTGCACAGGCAGCCTGG + Intergenic
1201538935 Y:15085156-15085178 AGGTCTCTGCAGAGGCATCCAGG - Intergenic
1202048346 Y:20756319-20756341 AGGTCTGAGAAGAGTGCGGCTGG + Intronic