ID: 1083159619

View in Genome Browser
Species Human (GRCh38)
Location 11:60847039-60847061
Sequence TCCCCCAGTTGGAGATGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083159619 Original CRISPR TCCCCCAGTTGGAGATGAAG TGG (reversed) Intronic
901195937 1:7439760-7439782 CTCCCCAGGTGCAGATGAAGGGG + Intronic
901655178 1:10765154-10765176 TCCCCCAGGTGAAAATCAAGGGG - Intronic
901843459 1:11967389-11967411 TCCCCCAGGTGGAGCTGGGGAGG + Intronic
902689327 1:18100185-18100207 TCACTCAGTTGGGAATGAAGAGG - Intergenic
903471142 1:23588219-23588241 TTCCCCAGGTAGAGAAGAAGGGG + Intronic
904442347 1:30539939-30539961 TCCTCCTGTTGGAGAAGTAGGGG - Intergenic
905785268 1:40750896-40750918 TACCACAGTTGGTGAGGAAGTGG + Intronic
905888189 1:41502913-41502935 ACTCCCATTTGCAGATGAAGGGG - Intergenic
906676388 1:47696737-47696759 CCCCTCATTTGGAGATGCAGAGG + Intergenic
906701288 1:47859978-47860000 TCACCCAACTGGAGATGCAGTGG + Intronic
909509878 1:76440413-76440435 AGCCCAAGTTGGAGATGATGGGG + Intronic
910687774 1:89935467-89935489 TCACTCAGCTGGAGCTGAAGGGG + Exonic
910787232 1:91013111-91013133 TCGCCCAGGTGGGGATGCAGTGG + Intronic
911977813 1:104523862-104523884 TCCCCTAGTTTAAGATGAGGGGG + Intergenic
915233991 1:154466994-154467016 TCCCCCAGGTGGTTATGGAGAGG + Exonic
919306874 1:195852285-195852307 TCCTTCAGTTGGAGAAGAATTGG - Intergenic
919727302 1:200892585-200892607 ACCACCAGTTGGTGAGGAAGTGG - Intronic
920624273 1:207580564-207580586 GCCCCAAGCTGGAGATTAAGTGG - Exonic
920626965 1:207611992-207612014 GCCCCAAGCTGGAGATTAAGTGG - Exonic
920636909 1:207712817-207712839 GCCCCAAGCTGGAGATTAAGTGG - Intronic
922080115 1:222287653-222287675 TGCCCCAGTGAGACATGAAGGGG + Intergenic
922448248 1:225716070-225716092 TCCCCCAGTTGCTGATGGTGTGG + Intergenic
924909787 1:248497852-248497874 TCCCCTAGTTGTAGATGTGGGGG - Intergenic
924914315 1:248550208-248550230 TCCCCTAGTTGTAGATGTGGGGG + Intergenic
1063548295 10:7003017-7003039 TTGTCCAGTTGGAGATGATGAGG - Intergenic
1064162906 10:12960971-12960993 TCTCTCAGTGGGAGATAAAGTGG + Intronic
1064340364 10:14480010-14480032 TCCCCCATAGGGAGATCAAGAGG + Intergenic
1064407270 10:15075178-15075200 TCCACCAGGTAGAGATGCAGGGG - Intergenic
1067717510 10:48700658-48700680 ACCCCCAGGTGGAGATGAGATGG - Intronic
1069228381 10:65973688-65973710 ACTCACAGTAGGAGATGAAGTGG + Intronic
1074141657 10:110678938-110678960 ACCCACACTTGGAGATAAAGAGG + Intronic
1075239511 10:120765144-120765166 TTCACCATTAGGAGATGAAGAGG + Intergenic
1075949512 10:126464565-126464587 TCTCCCAGTTGGAGAAGGGGAGG + Intronic
1076646424 10:131957839-131957861 ATCCCCATGTGGAGATGAAGGGG + Intronic
1076646482 10:131958057-131958079 ATCCCCATGTGGAGATGAAGGGG + Intronic
1077422253 11:2458175-2458197 TCCCCAAGCTGAAGATGCAGTGG + Intronic
1078421790 11:11218759-11218781 TCCTCCAGCTGGAGATGGAGAGG - Intergenic
1080524246 11:33098160-33098182 TCTCCCATTGGGAGAGGAAGGGG - Intronic
1082897053 11:58203263-58203285 TCCTCAAGCTGTAGATGAAGGGG + Exonic
1082898229 11:58215641-58215663 TCCTCAAGCTGTAGATGAAGGGG - Exonic
1083159619 11:60847039-60847061 TCCCCCAGTTGGAGATGAAGTGG - Intronic
1083530628 11:63418503-63418525 TCCCACAGTAGGACATGAAGAGG + Intergenic
1084171945 11:67405111-67405133 TCCGCCAACGGGAGATGAAGTGG + Exonic
1085482966 11:76837948-76837970 TCCCCCATATGGATATGAATGGG + Intergenic
1085972656 11:81611979-81612001 TCCCACAATAGGTGATGAAGGGG + Intergenic
1089323982 11:117644739-117644761 TGCACCAGGTGGAGCTGAAGGGG + Intronic
1089499766 11:118925325-118925347 CTCGCCAGTTGGAGATGCAGAGG + Intronic
1089707559 11:120290964-120290986 TCCCCCATTAGGAGGAGAAGAGG - Intronic
1090651009 11:128806003-128806025 TCCCCCAGTAAGAGAATAAGGGG + Intronic
1091656307 12:2349068-2349090 TCCCCATGTTATAGATGAAGGGG - Intronic
1096386590 12:51198581-51198603 TCCCCCCGTAGGAGAAGCAGCGG + Exonic
1098886882 12:75969447-75969469 TACCCCATTTGGAGCTGAAAGGG - Intergenic
1099110471 12:78553800-78553822 TTCTCCAGTTGGAAAGGAAGGGG + Intergenic
1100653807 12:96618821-96618843 TCCCCAAATGGGAGAAGAAGGGG - Intronic
1101018943 12:100531971-100531993 TTCCTCAGTTTGGGATGAAGAGG - Intronic
1101823222 12:108200190-108200212 TCCTCCAGCTGGAGATGCAATGG + Intronic
1102172589 12:110853397-110853419 TCCCCCAGTTGAAGAAGAACAGG + Exonic
1103246353 12:119461286-119461308 TTCCCCATTTGAAGATGAAGGGG + Intronic
1103353293 12:120300747-120300769 TCCCCCATTTTAAGATGAATTGG - Intergenic
1103394753 12:120599046-120599068 TTCCCCAGTTGCAGAACAAGTGG - Intergenic
1104479134 12:129091930-129091952 TCCCCCTCTGGGAGATGAACTGG + Intronic
1110888288 13:80666506-80666528 TCCCAGACTTGGAGCTGAAGAGG - Intergenic
1113203108 13:107888317-107888339 TGCCACAGCTGGAGATGGAGTGG + Intergenic
1118294272 14:64554594-64554616 TACTCCAGTTGGTGGTGAAGAGG + Intronic
1120157121 14:81105756-81105778 TGCAGCAGTTAGAGATGAAGAGG + Intronic
1127127602 15:55827382-55827404 GCCCCTAGTGGGAGATGAAGGGG + Exonic
1128401260 15:67283812-67283834 TGCCCCAATTTGAGATGCAGAGG + Intronic
1128543122 15:68550806-68550828 TCCCCCTTTGGGAAATGAAGAGG - Intergenic
1131973644 15:97918910-97918932 GCCCCAATTTGGAGATGAAGAGG + Intergenic
1132032286 15:98448064-98448086 TCCTCCTGTTGAAGATGCAGTGG - Intronic
1133463940 16:6011795-6011817 TCTCCAAGTTGGAGACGAGGAGG + Intergenic
1139517968 16:67462977-67462999 TCACTCAGTTGGAGGTGGAGGGG + Intronic
1140282629 16:73568586-73568608 TCCCACAGTTGGACAAGAAAGGG + Intergenic
1143020697 17:3915975-3915997 TCCCCTGGATGGAGAGGAAGAGG + Intronic
1144277622 17:13689163-13689185 TACCTCAGTTGGAAATGCAGAGG + Intergenic
1147428538 17:40357493-40357515 TCCCCCAGCTGGGGGTGCAGGGG - Intronic
1151404712 17:73878870-73878892 TCCCCGAGATGGAGAAAAAGAGG + Intergenic
1154031000 18:10754341-10754363 GACCCCTGTTGGAGAGGAAGAGG + Intronic
1158007881 18:52694088-52694110 TCCCCCAGTATGATATGATGAGG + Intronic
1158202039 18:54951854-54951876 CCTCCCAGCTGGTGATGAAGTGG - Intronic
1160436144 18:78854321-78854343 TTCCCCAGTGGGTGATGATGGGG - Intergenic
1160436180 18:78854477-78854499 TTCCCCAGTGGGTGATGATGGGG - Intergenic
1160436342 18:78855500-78855522 TCCCCCAGTGGGTGATGATGGGG - Intergenic
1160436353 18:78855549-78855571 TCCCCCAGTGGGTGATGATGGGG - Intergenic
1160436365 18:78855598-78855620 TCCCCCAGTGGGTGACGATGGGG - Intergenic
1160436377 18:78855647-78855669 TCCCCCAGTGGGTGATGATGGGG - Intergenic
1160436387 18:78855696-78855718 TCCTCCAGTGGGTGATGATGGGG - Intergenic
1160436399 18:78855745-78855767 TCCCCCAGTGGGTGACGATGGGG - Intergenic
1161082857 19:2320071-2320093 TTCCCGAGCTGGGGATGAAGGGG + Intronic
1161349346 19:3783612-3783634 TCCCCAATGTGGAGATGAAGGGG - Intronic
1162519873 19:11173481-11173503 TCCCCCAGTAGGAGAGGGAAGGG + Intronic
1162571390 19:11475954-11475976 TCAGCCAATTGGAGATGCAGGGG - Intronic
1162914924 19:13869509-13869531 TCCCGCAGCTGGAAAGGAAGTGG + Intronic
1163584094 19:18154650-18154672 TGGCCCAGTTGGACATGAGGGGG - Intronic
1164709225 19:30343520-30343542 GTGCCCAGGTGGAGATGAAGGGG + Intronic
1166181331 19:41111375-41111397 TCCTCCAGTTGGCGATGGAATGG + Intergenic
1168712619 19:58510727-58510749 TCCCCGAGGTATAGATGAAGAGG + Exonic
925451929 2:3976326-3976348 TGCCCTAATGGGAGATGAAGGGG - Intergenic
927567465 2:24125341-24125363 TCACCCAGGTGGGGATGCAGTGG - Intronic
928168456 2:28987956-28987978 TCTCGCAGTTGGGGGTGAAGTGG + Intronic
928306887 2:30177687-30177709 TCCCCATTTTGCAGATGAAGAGG - Intergenic
929782128 2:44964060-44964082 TCCCCCTTGTGGAGATCAAGTGG - Intergenic
931182553 2:59917333-59917355 GCCCCCAGGAGGAGAAGAAGGGG + Intergenic
931197672 2:60068210-60068232 TACCCCAGGTGGAGATGTGGGGG - Intergenic
932775847 2:74527974-74527996 TCCCCTAGTTGGCGATGAACAGG + Exonic
933621037 2:84541667-84541689 TCCTCCAAATGGAGATGGAGAGG - Intronic
939989992 2:148868835-148868857 TCCTCCAGCTGGAGATGGAAAGG + Intergenic
941751773 2:169141991-169142013 TCCCCCAGTTTTAGCTGATGGGG - Intronic
944792396 2:203144302-203144324 TCCCACAGTGAGAGATGAAGAGG - Intronic
948659668 2:239499217-239499239 TCACCCAGCTGGAGATGTAAGGG - Intergenic
1168926871 20:1588721-1588743 TCCCTCAGTTCAAGAGGAAGTGG + Intronic
1173222022 20:41138397-41138419 TCCCCCAGAGGGAGATGAGTAGG - Intronic
1177565987 21:22820591-22820613 TACCACAGTTGAAGATGAATGGG + Intergenic
1177607154 21:23395572-23395594 TCCCACTGTTGGAGATGCTGAGG + Intergenic
1177692557 21:24530585-24530607 TATCACAGTTGAAGATGAAGGGG + Intergenic
1178900406 21:36593457-36593479 TGCCCCAGTGGGAGAGGAGGAGG + Intergenic
1181321511 22:22010442-22010464 TCAGCCAGTTGGAGATGACAGGG + Intergenic
1184992524 22:48180450-48180472 GCCCCCAGCTGAAGAAGAAGGGG + Intergenic
950114648 3:10442958-10442980 TCCCACAGCTGGATAAGAAGTGG + Intronic
951881715 3:27485927-27485949 ATACCCAGTTGGAGATGAATAGG - Intergenic
954584640 3:51722517-51722539 TCCCCCAGGTGGCGATGAAGCGG + Intergenic
959749216 3:109813274-109813296 ACCCCCAGGTGAAGATGATGTGG + Intergenic
959861549 3:111221940-111221962 TCACCAAGTTGGATATGAATGGG - Intronic
961187405 3:124927659-124927681 TCCATCATTTGGAGATGAAGCGG + Exonic
961755893 3:129127219-129127241 TCAGCCAGTTGGGGATGCAGCGG + Intronic
963535937 3:146528679-146528701 TCAGCCAGTTGGAGCTGCAGGGG - Exonic
963607487 3:147423600-147423622 TCCTCCGGTTGTAGATGAAAAGG + Intronic
964794579 3:160483118-160483140 TCCCTCAGTGGAAGGTGAAGGGG - Intronic
965665100 3:171085139-171085161 TCCCACTGATGAAGATGAAGAGG - Exonic
965878261 3:173354750-173354772 TACCCTAGTAGGAAATGAAGGGG - Intergenic
967288831 3:187899569-187899591 TCACCCATTTGGAGATGGTGAGG - Intergenic
967576283 3:191097275-191097297 TACTCAAGATGGAGATGAAGGGG - Intergenic
968510983 4:995833-995855 GCCCCCATTTGGAGGTGAAATGG + Intronic
968835980 4:2964238-2964260 TCCCCCAGTGGGAGGTGTCGGGG - Intronic
969460085 4:7324401-7324423 TTGCCCAGTTGGAGCTGCAGGGG - Intronic
970391770 4:15619121-15619143 TCACCCAGTTGGGAATGCAGTGG - Intronic
970610550 4:17721480-17721502 TCACCCAGGTGGACAGGAAGGGG + Intronic
972641125 4:40925962-40925984 TACCTCAGATGGAGAGGAAGAGG - Intronic
973080789 4:45990316-45990338 TCCCTCAGTTGTAGTTCAAGTGG - Intergenic
974608470 4:64184068-64184090 AGCCACAGTTGGAGCTGAAGTGG + Intergenic
975018580 4:69457805-69457827 TCACCCACTTGAAGAAGAAGAGG - Intergenic
981122264 4:141065854-141065876 TCCCCCAAATAGAGATGATGTGG + Intronic
984655269 4:182310643-182310665 TCCCCCACATGGAGACAAAGGGG - Intronic
984829881 4:183963136-183963158 TCCCCCAGGTGTAGATGAGTGGG + Intronic
988365275 5:30290326-30290348 TCCCAGACTTGGAGCTGAAGAGG + Intergenic
990669959 5:58117119-58117141 TCCCACAGGTGTGGATGAAGGGG + Intergenic
992439331 5:76784459-76784481 TCCCCTTGGTGGAGAGGAAGGGG + Intergenic
995171019 5:109112231-109112253 TTATCCAGTTGTAGATGAAGAGG + Intronic
996380744 5:122860516-122860538 TAGCCCTGTAGGAGATGAAGGGG + Intronic
997597962 5:135119686-135119708 TCCCCAAGTTAGACAAGAAGAGG - Intronic
998856709 5:146401087-146401109 TCCCCCCTTTGCTGATGAAGAGG + Intergenic
1000636465 5:163649616-163649638 TGCCCCAGTGGGAAATGAAGGGG + Intergenic
1003531152 6:6938694-6938716 TGGCCCAGGTGGAAATGAAGCGG - Intergenic
1004146930 6:13076641-13076663 TGGCCCAGTTGGAGCTGGAGTGG + Intronic
1005350636 6:24931497-24931519 TCTCCCAGATGGAGATGAACTGG - Intronic
1006681038 6:35796993-35797015 TGCTCCAGTTGGAGCTGGAGAGG + Intronic
1007138253 6:39543814-39543836 GCCTCCAGTTGCAGACGAAGTGG - Intronic
1007794499 6:44336919-44336941 GCTCCAAGTTGGAGACGAAGAGG - Intronic
1012081997 6:94770921-94770943 TCTCCCAGTTGGACTTGAAGGGG + Intergenic
1013446245 6:110231146-110231168 TTCCCCAGTTTGAGAAGCAGTGG + Exonic
1014202370 6:118620825-118620847 TCTCCCAGTTGCAGCTGAGGAGG - Intronic
1016563422 6:145423806-145423828 TCTCCCAAGTGGAGATTAAGAGG + Intergenic
1017516497 6:155160719-155160741 TACCCCAGCTGGGGATGCAGTGG - Intronic
1017658216 6:156649865-156649887 TCCCTCACTTAGAGAGGAAGAGG + Intergenic
1023021502 7:36015550-36015572 TCCCAGATTTGGAGCTGAAGAGG - Intergenic
1023615711 7:42017429-42017451 GCCCCCAGGTGGAGTTTAAGAGG - Intronic
1024151024 7:46571419-46571441 TGCCCCTGTTGTAGCTGAAGAGG - Intergenic
1024348064 7:48333765-48333787 TCCAGCAGTTGGAGAAGAAGGGG + Intronic
1024348103 7:48333982-48334004 TCCCCCTGTTGGTGTTGCAGGGG + Intronic
1028744738 7:94315158-94315180 AGCCCCAGTGGAAGATGAAGAGG - Intergenic
1029518156 7:101041018-101041040 TTCAGCAGTTGTAGATGAAGTGG - Exonic
1029671039 7:102031096-102031118 TCCCCCAGGCTGGGATGAAGTGG + Intronic
1031138491 7:117913791-117913813 TGCCCCAGTTGGAGTACAAGTGG + Intergenic
1031983754 7:128148786-128148808 TACCCCAGTGGGATAGGAAGGGG - Intergenic
1032166930 7:129552890-129552912 TGGCACAGGTGGAGATGAAGGGG - Intergenic
1034832453 7:154321379-154321401 TGCCACAGCTGGAGTTGAAGAGG + Intronic
1036134573 8:6148301-6148323 TCCCCCAGTGTGAGAAGGAGTGG - Intergenic
1037422865 8:18722566-18722588 TCCTTCAGGTGGAAATGAAGGGG - Intronic
1039869899 8:41537226-41537248 TCCACCAAATGGAGATGGAGAGG + Exonic
1043524654 8:81083283-81083305 CACCCCAGTTGGAGAGGAAAAGG + Intronic
1045390281 8:101708349-101708371 TCCACCAATTGGAGATTTAGTGG + Intronic
1052764991 9:32631997-32632019 TCGCACATTTCGAGATGAAGAGG - Exonic
1052946346 9:34171499-34171521 TCGCCCAGGTTGGGATGAAGTGG + Intergenic
1053215687 9:36268626-36268648 TCCCCCAGGCTGAGATGCAGTGG - Intronic
1053477680 9:38393745-38393767 TCCCCCTGTGGGATATGATGAGG + Intronic
1056495164 9:87148767-87148789 ACCCCCAGGAGGAGATGCAGGGG - Exonic
1056833221 9:89933238-89933260 GCCCCCAGTAGGAGGTGAAGAGG + Intergenic
1059398252 9:114052376-114052398 TCCCCCAGTTGGAAATGTTGTGG - Exonic
1062139737 9:134949296-134949318 CCCCCCAGTAGGCGAGGAAGGGG - Intergenic
1062359122 9:136179084-136179106 TTCCCCAGCTGCAGCTGAAGAGG - Intergenic
1185480699 X:444148-444170 TCAGCCAGTGGGAGAGGAAGAGG + Intergenic
1190147271 X:47905572-47905594 TTCCCCAGTTTGAGAAGCAGTGG - Intronic
1190491678 X:50988945-50988967 TCTCCAAGTGGGGGATGAAGGGG - Intergenic
1194031936 X:88828390-88828412 TGCCCCAGTTGTAGTTCAAGTGG + Intergenic
1194353144 X:92846854-92846876 TGACCCAGTTGGAGATGAGGTGG + Intergenic
1195029763 X:100914946-100914968 TCCGCCAGATGGTGATGCAGAGG + Exonic
1196191842 X:112802987-112803009 TCAGCCAGTTGGAGATAAATGGG - Intronic
1197787935 X:130218742-130218764 TCCCCATATTAGAGATGAAGAGG - Intronic
1199720115 X:150537281-150537303 TTCCCCACTTAGAGATGAAGAGG + Intergenic
1200661500 Y:5963943-5963965 TGACCCAGTTGGAGATGAGGTGG + Intergenic