ID: 1083159926

View in Genome Browser
Species Human (GRCh38)
Location 11:60848553-60848575
Sequence AGCCAGGAAGCCCCTGTAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 195}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083159918_1083159926 -5 Left 1083159918 11:60848535-60848557 CCCTGTCACCCATCCCAGAGCCA 0: 1
1: 0
2: 1
3: 33
4: 308
Right 1083159926 11:60848553-60848575 AGCCAGGAAGCCCCTGTAAAGGG 0: 1
1: 0
2: 1
3: 16
4: 195
1083159916_1083159926 6 Left 1083159916 11:60848524-60848546 CCACTTCTGTCCCCTGTCACCCA 0: 1
1: 0
2: 3
3: 54
4: 491
Right 1083159926 11:60848553-60848575 AGCCAGGAAGCCCCTGTAAAGGG 0: 1
1: 0
2: 1
3: 16
4: 195
1083159914_1083159926 14 Left 1083159914 11:60848516-60848538 CCTTTCCTCCACTTCTGTCCCCT 0: 1
1: 0
2: 12
3: 149
4: 1715
Right 1083159926 11:60848553-60848575 AGCCAGGAAGCCCCTGTAAAGGG 0: 1
1: 0
2: 1
3: 16
4: 195
1083159912_1083159926 20 Left 1083159912 11:60848510-60848532 CCCGCACCTTTCCTCCACTTCTG 0: 1
1: 0
2: 1
3: 46
4: 382
Right 1083159926 11:60848553-60848575 AGCCAGGAAGCCCCTGTAAAGGG 0: 1
1: 0
2: 1
3: 16
4: 195
1083159915_1083159926 9 Left 1083159915 11:60848521-60848543 CCTCCACTTCTGTCCCCTGTCAC 0: 1
1: 0
2: 2
3: 38
4: 471
Right 1083159926 11:60848553-60848575 AGCCAGGAAGCCCCTGTAAAGGG 0: 1
1: 0
2: 1
3: 16
4: 195
1083159911_1083159926 21 Left 1083159911 11:60848509-60848531 CCCCGCACCTTTCCTCCACTTCT 0: 1
1: 1
2: 0
3: 28
4: 434
Right 1083159926 11:60848553-60848575 AGCCAGGAAGCCCCTGTAAAGGG 0: 1
1: 0
2: 1
3: 16
4: 195
1083159910_1083159926 22 Left 1083159910 11:60848508-60848530 CCCCCGCACCTTTCCTCCACTTC 0: 1
1: 0
2: 2
3: 46
4: 628
Right 1083159926 11:60848553-60848575 AGCCAGGAAGCCCCTGTAAAGGG 0: 1
1: 0
2: 1
3: 16
4: 195
1083159919_1083159926 -6 Left 1083159919 11:60848536-60848558 CCTGTCACCCATCCCAGAGCCAG 0: 1
1: 0
2: 4
3: 28
4: 353
Right 1083159926 11:60848553-60848575 AGCCAGGAAGCCCCTGTAAAGGG 0: 1
1: 0
2: 1
3: 16
4: 195
1083159913_1083159926 19 Left 1083159913 11:60848511-60848533 CCGCACCTTTCCTCCACTTCTGT 0: 1
1: 1
2: 6
3: 80
4: 1390
Right 1083159926 11:60848553-60848575 AGCCAGGAAGCCCCTGTAAAGGG 0: 1
1: 0
2: 1
3: 16
4: 195
1083159917_1083159926 -4 Left 1083159917 11:60848534-60848556 CCCCTGTCACCCATCCCAGAGCC 0: 1
1: 1
2: 2
3: 28
4: 492
Right 1083159926 11:60848553-60848575 AGCCAGGAAGCCCCTGTAAAGGG 0: 1
1: 0
2: 1
3: 16
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083159926 Original CRISPR AGCCAGGAAGCCCCTGTAAA GGG Intronic
901051104 1:6426286-6426308 GGCCAGGAAGCCCTGGTAACAGG - Intronic
902720675 1:18302120-18302142 GGCCAGGCAGCCCCTGAAGAAGG - Intronic
904390665 1:30183808-30183830 AGTCAGGAAACATCTGTAAATGG + Intergenic
906062511 1:42958117-42958139 AGCCCGGACGCCCCTGTAGGTGG - Intronic
909151184 1:72007483-72007505 AGCCAGGGTGCCCCTGAAGAAGG + Intronic
911911040 1:103635543-103635565 AGCCAGGAATAACCTGCAAAGGG - Intergenic
911918455 1:103729685-103729707 AGCCAGGAATAACCTGCAAAGGG - Intronic
914224351 1:145707821-145707843 GGCCAGTAAGCCCCAGGAAATGG + Intronic
915735215 1:158080372-158080394 ATCCAGGAAGAACCTGGAAAAGG + Intronic
916215187 1:162387672-162387694 AGCCAGGGAGCCCCTGCATGCGG - Intergenic
916344438 1:163771968-163771990 AGCCAGGAAGACCAGTTAAAAGG + Intergenic
917677485 1:177333567-177333589 AGGCAGGAAGACCATGAAAAAGG + Intergenic
919926612 1:202194789-202194811 AGCCAGGAGGCCCCAGTGAAGGG - Intronic
921554656 1:216583539-216583561 AGCCATGAAGCCCCTGTAGAGGG - Intronic
1064162742 10:12959853-12959875 GGCCAGGAAACCCCTTAAAAAGG - Intronic
1068371177 10:56117696-56117718 TTCCAAGAAGCCCCTGTACATGG - Intergenic
1068867887 10:61914158-61914180 AGCCAGGAGGGCCCTCTAATGGG + Intronic
1069569092 10:69483755-69483777 AGCCAGGAAGGCACTTTCAAGGG - Exonic
1073119089 10:101110737-101110759 AGCCACAAAGCCCCTCTAATGGG - Intronic
1073586537 10:104715989-104716011 AGCAAGGAGACTCCTGTAAATGG - Intronic
1075105746 10:119538940-119538962 ACCCAGGAAGCCCTAGGAAATGG + Intronic
1077541594 11:3149134-3149156 AGGCTGGAAGCCTCTGGAAAGGG - Intronic
1077878261 11:6325756-6325778 ACCCAGGATGCTCCTGCAAATGG + Intergenic
1078002866 11:7512169-7512191 CTCCAGGAAGCCCCTGTTAAGGG + Intergenic
1078433306 11:11303924-11303946 AGCCAGGCAGCCCCTCCAAGGGG - Intronic
1078556665 11:12332710-12332732 AGCTAGGGAGCCCCAGGAAAAGG + Intronic
1080429607 11:32186051-32186073 AGCTAGGAAGCAACTGGAAATGG - Intergenic
1080829734 11:35880444-35880466 AGCCAGTAAGCACATGAAAAAGG - Intergenic
1081620852 11:44618533-44618555 AGCCCGGAAGCCCCTACAGAGGG - Intronic
1082007460 11:47427416-47427438 AGCCCTGGAGCCCCTTTAAAGGG + Intergenic
1082757431 11:57091982-57092004 AGCCTGGATGCTCCTGTAGAAGG + Intergenic
1083031750 11:59598886-59598908 AGCCAGGATGCACCCTTAAATGG + Intronic
1083159926 11:60848553-60848575 AGCCAGGAAGCCCCTGTAAAGGG + Intronic
1083725050 11:64623505-64623527 AGCCATGGAGCCCCTGGAAGAGG + Intronic
1085945918 11:81272989-81273011 GGCAAGGAAGCACCTGTATATGG - Intergenic
1087128855 11:94651870-94651892 AGACAGGTATCCCTTGTAAAAGG - Intergenic
1087226049 11:95600489-95600511 ACCCAGAAATTCCCTGTAAAAGG - Intergenic
1089222945 11:116890305-116890327 AGCAAGGAAGGCCCTGTGACTGG + Intronic
1092145969 12:6214922-6214944 AGCCAGGAAGTCATGGTAAAGGG - Intronic
1092650777 12:10632428-10632450 AGCCAGGAAGCCAGTGTAGCTGG + Intronic
1093124072 12:15307278-15307300 AGTCATGAGGCCCCTGTACAAGG - Intronic
1093743524 12:22714249-22714271 AGCCTGGAAGACTCTGCAAAAGG + Intergenic
1094605210 12:31943702-31943724 AGACAGGTGGCCCTTGTAAAAGG + Intergenic
1095790880 12:46165753-46165775 AGCCAAGAAGCCAGTGTAACTGG + Intergenic
1098908741 12:76188117-76188139 ACACAGCAAGCCCCTGGAAAAGG + Intergenic
1100359285 12:93861445-93861467 AGCCAGGAAGCTCCAGCTAATGG + Intronic
1101277896 12:103222349-103222371 AGCCAGGATGACCCAGGAAAAGG + Intergenic
1101278774 12:103228337-103228359 AGCCAGGATGACCCAGGAAAAGG + Intergenic
1101593461 12:106142126-106142148 AGCCAGGAAGAGCCAGGAAAAGG + Intergenic
1105010040 12:132749547-132749569 ATCCAGGAAGCACCTGTATAAGG + Intronic
1105242963 13:18624055-18624077 AGCCAGCTAGTCCCTGTCAAAGG + Intergenic
1106655722 13:31744019-31744041 ATCCAGGAAGCCCCTGGGGAGGG - Intronic
1115027546 14:28761827-28761849 AGCTAGGGAGCCACTTTAAAAGG - Intergenic
1115445386 14:33483899-33483921 AACCAGGAAGCCTTTCTAAAAGG - Intronic
1118929720 14:70230253-70230275 AGCCAGAGAGCACCTGTCAAGGG - Intergenic
1118954864 14:70471170-70471192 AGCCAGAGAGCACCTGTCAAGGG + Intergenic
1119654141 14:76404917-76404939 ACCCAGGAAGCCCCTCAGAAGGG + Intronic
1121450581 14:94004609-94004631 AGCCAGGAAGCCCTTCTGAAAGG + Intergenic
1122721574 14:103725323-103725345 AGCTAGGAACCCCCTGCAAGTGG + Intronic
1123488331 15:20760576-20760598 AGCCAGCTAGTCCCTGTCAAAGG - Intergenic
1123544829 15:21329649-21329671 AGCCAGCTAGTCCCTGTCAAAGG - Intergenic
1124147760 15:27144318-27144340 AGCCTGGTAGCCCCTGGAAGAGG + Intronic
1124989769 15:34660139-34660161 ACCCAGGAATCCCCTGAAGAGGG + Intergenic
1129606816 15:77029030-77029052 AGCCAGGAAGCAGCAGAAAAGGG + Intronic
1130048263 15:80462656-80462678 GGCCAGGAAGCCCCTTGATAAGG - Intronic
1130657685 15:85803486-85803508 AGCCAGCAGCCCCCTGTAAGTGG + Intergenic
1202953174 15_KI270727v1_random:56920-56942 AGCCAGCTAGTCCCTGTCAAAGG - Intergenic
1132648047 16:1008043-1008065 ACCCAGGAAGCCCCTTCAAGGGG + Intergenic
1132844575 16:1993897-1993919 GGCCAGGAAGCCAAGGTAAAGGG - Exonic
1133421009 16:5646929-5646951 AGCCAGGAAGACCCTCTTGATGG + Intergenic
1136246997 16:28981942-28981964 AGCCAGGGAGCCCGTGACAAAGG - Exonic
1137614945 16:49840902-49840924 GGCCAGGAAGCCCCTTGAGAAGG + Intronic
1137848510 16:51715153-51715175 AGCCAGGATGCTTCTGCAAAGGG - Intergenic
1138554270 16:57762835-57762857 AGCCAGGAGGCCCCTGTGGCCGG - Intronic
1140565285 16:76035053-76035075 AGACAGGTGGCCCTTGTAAAAGG + Intergenic
1140590602 16:76347767-76347789 AGCAAGGAGGCCATTGTAAATGG + Intronic
1140795241 16:78431468-78431490 ATCCAGGAAAGCCCTGTCAAAGG + Intronic
1141544987 16:84760770-84760792 GGCCAGGGAGCCCTTATAAAAGG + Intronic
1146470366 17:33119567-33119589 AGCAAGGAAGCTGCTGTAGATGG + Intronic
1151424427 17:74021527-74021549 AGCCAGGCAGCCCCAGAAGAAGG + Intergenic
1152893639 17:82897129-82897151 AGCAAGGAAGCATCTGAAAAAGG - Intronic
1153125380 18:1784638-1784660 ATCCAGGAAGCCCCGATGAATGG + Intergenic
1153250591 18:3117812-3117834 AGCCATGAAGCCAAGGTAAAGGG - Intronic
1153984194 18:10338409-10338431 AGCCAGGATGCCTGTGCAAAGGG + Intergenic
1154445976 18:14435842-14435864 AGCCAGCTAGTCCCTGTCAAAGG - Intergenic
1155215994 18:23643228-23643250 AGGCAGAAAGGCCCTGTGAATGG - Intronic
1155646092 18:28079672-28079694 AGCCAACAAGCCCCTGAGAAGGG + Intronic
1159511832 18:69404249-69404271 AACCTGGAAGCCCCTCTGAAAGG - Intronic
1162775388 19:12975738-12975760 AGCCACGCAGCCCCTGGGAAGGG - Intergenic
1163002338 19:14376037-14376059 TGCCAGGAAGCCCCAGAGAACGG - Intergenic
1163129903 19:15265843-15265865 AGCCAGGACGCCCTAGGAAATGG - Intronic
1166656059 19:44612995-44613017 TGGCAGAAAGCCCCTGTGAACGG + Intergenic
1167256186 19:48430657-48430679 AGCCATGAAGCAACTGAAAAAGG - Intronic
1167949637 19:53015853-53015875 GGCAAGGAAGCCCCTGGGAAAGG + Exonic
1168425151 19:56234196-56234218 AACCAGGAAGACCTTGAAAATGG - Intronic
1168527465 19:57100270-57100292 GGCCAGGGAGCCCCTTTAGATGG - Intergenic
927563735 2:24092967-24092989 AGGCAGGTAGCCTCTGTACATGG - Intronic
930854156 2:55994533-55994555 ACCTAGGAAGCACCTGTAAAAGG + Intergenic
932796694 2:74701876-74701898 AGCCTGGAAGCCCAGGAAAAAGG + Intergenic
937257079 2:120563326-120563348 AGCCCAGAAGCCCCCGTGAAGGG + Intergenic
939111508 2:138013356-138013378 AGCCAGGAAGCCAGTGAAATTGG - Intronic
939451072 2:142375795-142375817 ATCTAGGAAGTCCCTGTAAAAGG + Intergenic
940377150 2:152969444-152969466 AGACAGGTGGCCCTTGTAAAAGG + Intergenic
941613392 2:167689645-167689667 AGCCAGGAAGATCCTCTTAAAGG - Intergenic
941657516 2:168159889-168159911 AGGCAGGAAGCCCCTGCACAGGG - Intronic
942206375 2:173623771-173623793 AGGCAGGAAGCCCAAGAAAAAGG + Intergenic
948769073 2:240238779-240238801 AGCCAGGAAATCCCTGGAAAAGG - Intergenic
1169826314 20:9772486-9772508 AGCCAGGAAGCTCATGTCACCGG + Intronic
1169972120 20:11279301-11279323 AGCCTGGCAGCCTCTGCAAAGGG - Intergenic
1170560986 20:17558279-17558301 AGTCAGGAAGCCATTTTAAATGG - Intronic
1171721085 20:28564017-28564039 AGCCAGGATGTCCCTGATAAAGG - Intergenic
1172740117 20:37160060-37160082 AACCAGGATGCCCGTGTAAGGGG + Intronic
1173980171 20:47217890-47217912 AGGCAAGAAGCCCCAGTAAATGG - Intronic
1174186659 20:48711035-48711057 AGCCAGGGAGGTCCTTTAAAGGG - Intronic
1175402209 20:58707219-58707241 ACCCAGGATGCCCCTGCAGAGGG - Intronic
1175570059 20:60011704-60011726 AGCCGGCTAGCCCCTGTAACAGG + Intronic
1176450004 21:6854015-6854037 AGCCAGCTAGTCCCTGTCAAAGG + Intergenic
1176828173 21:13719033-13719055 AGCCAGCTAGTCCCTGTCAAAGG + Intergenic
1178067512 21:28922041-28922063 AGTCAGGAAGCCCTTTTAAAGGG + Intergenic
1178434297 21:32544268-32544290 AGCCAGGCAGCCTCCATAAAGGG - Intergenic
1178777531 21:35566321-35566343 AGCAAAGAAGCCCCAGTACAAGG - Intronic
1179481799 21:41683017-41683039 AGCCAGCCAGCCCATGTACAGGG + Intergenic
1183402748 22:37614194-37614216 AGCCACGAACCCCCTGAACAAGG + Exonic
1183744275 22:39684385-39684407 AGCCAGAAAGGCCCAGAAAAGGG + Exonic
1185045912 22:48528710-48528732 AGCCAGGAACACCCTGGAAGCGG + Intronic
949869287 3:8574140-8574162 AGCCAGTGAGCCCATGAAAAAGG + Intergenic
950585610 3:13890300-13890322 ACCCAGGAAGCCCCTGGAGCAGG + Intergenic
952707969 3:36399274-36399296 AGACAGGAACCCACTGTAGAGGG - Intronic
953532696 3:43752664-43752686 AGGCAGAAAGCCCCTGGACAGGG + Intergenic
957418718 3:79939971-79939993 AGCCACGGAGCCCTTTTAAATGG - Intergenic
958786048 3:98597305-98597327 GGCCAGGAAGCTCCTGTATCTGG - Intergenic
958845489 3:99260205-99260227 AGACAGGTAGCCCTTGAAAAGGG + Intergenic
959684288 3:109128068-109128090 AGGCAGGAAGCCACTGTGGAAGG - Intergenic
959884158 3:111479358-111479380 ACCCAGGAAGTCTCTGTAACGGG - Intronic
960615978 3:119596403-119596425 AGCCAGGAAGCGCCTTTAGATGG - Intergenic
962681897 3:137808778-137808800 AGCCAGGAAGCCAATGTGACTGG - Intergenic
963627906 3:147696279-147696301 AGCAAAGAAGCCAGTGTAAAAGG + Intergenic
965402669 3:168231623-168231645 GGCCAGGAAGCCCCTAAACATGG - Intergenic
965935336 3:174102652-174102674 AGCCAGGTAGCACCTGCAATTGG - Intronic
976776348 4:88710425-88710447 AGCCAGGAGGACCCTGGTAATGG - Intergenic
979663722 4:123287982-123288004 AGCCAGGAAGCCAATGTCACTGG + Intronic
980179460 4:129386341-129386363 AGCCAGGAGGCGCCAGGAAAAGG + Intergenic
981290605 4:143071030-143071052 TGCCAGCAAGCTCCTGTATAAGG + Intergenic
984543142 4:181066789-181066811 AGGTAGGAAGCGCTTGTAAAGGG + Intergenic
986649445 5:9949003-9949025 AGCCAGGAATCCCATGTGATTGG + Intergenic
986870104 5:12036008-12036030 ACCCAGGTATCCCCTCTAAATGG - Intergenic
991598848 5:68332751-68332773 ATTCAGGAAACCCCAGTAAATGG + Intergenic
992549518 5:77847514-77847536 AGCCTTGAAGCCCCTGAAAAGGG - Intronic
994099459 5:95877812-95877834 AGCCTGGAAACATCTGTAAAAGG + Intergenic
995297388 5:110537546-110537568 AGACAGGTAGCCCTTGTAAAAGG - Intronic
999657901 5:153828584-153828606 TGCCAGGGAGCCCCAGTCAAGGG - Intergenic
1002303122 5:178268744-178268766 GGCCTGGAAGTCCCTGGAAAAGG + Exonic
1003090402 6:3097281-3097303 AGCCAGGATGCCCTTGAAGAAGG + Intronic
1004186562 6:13426313-13426335 AGCCAGGAAGCCACAGAAACAGG + Intronic
1005695283 6:28346110-28346132 AAACAGGGAGTCCCTGTAAATGG + Intronic
1010826114 6:80477861-80477883 AGTCAGGAAGCTCCTTTAACAGG + Intergenic
1011487917 6:87862092-87862114 AGCCAGGAAGAGCCAGGAAAAGG + Intergenic
1014506904 6:122270254-122270276 AACAAGGAAGCACCTGTGAAAGG - Intergenic
1015154427 6:130075716-130075738 AGGCAGGAAGCCACTGTGGAGGG + Intronic
1017502904 6:155042074-155042096 AGCCAGGAGGCCACAGGAAAAGG - Intronic
1017616139 6:156248753-156248775 AGCCAGGCAGCATCTATAAAGGG - Intergenic
1018173809 6:161162360-161162382 AGCCATGAAGCTTCTGTAACCGG - Intronic
1018377974 6:163231584-163231606 AGCCAGGATGCCTCAGCAAAAGG + Intronic
1018653140 6:166007836-166007858 AGCCAGGAAGGCACTGCAAGGGG + Intergenic
1019257855 7:63179-63201 GGCCAGGAAGCCCCTGCCCATGG - Intergenic
1019616316 7:1964226-1964248 AGTCAAGAAGCCCCTGCAGAAGG - Intronic
1021106443 7:16644952-16644974 AGCCAGGGAGGCCCTGGATACGG + Intronic
1021948808 7:25754235-25754257 AGCCAGAAAGCTCGGGTAAACGG - Intergenic
1022958143 7:35400258-35400280 AGACAAGAAGTCCCTGTCAAAGG + Intergenic
1025235948 7:57234947-57234969 AGCCTGGCAGCCACTGTCAAGGG - Intergenic
1026330226 7:69345475-69345497 AGCCAGAAAGCCCCTTTTACTGG + Intergenic
1033470819 7:141647414-141647436 AGCAAGGAAGCCCGTGTAGCTGG - Intronic
1034404981 7:150897109-150897131 AGCCATGCAGCCCCAGGAAATGG + Intergenic
1035070598 7:156142255-156142277 AGGCAGGAAGCTCTTGTCAAAGG + Intergenic
1036695200 8:10969768-10969790 AGCCAGGAGGCCACAGTATATGG + Intronic
1038001922 8:23399281-23399303 AGCCAGGCAGCCCCTGGGAATGG + Intronic
1040306101 8:46212640-46212662 ATGCTGGGAGCCCCTGTAAAAGG + Intergenic
1045481788 8:102598580-102598602 TGCCAAGAAGCCCCAGTAATTGG - Intergenic
1048961726 8:139585228-139585250 AAGCAGGAAGTCCCTGTCAATGG + Intergenic
1049446693 8:142634575-142634597 AGCAAGGAAGCCCCTGGCAGGGG - Intergenic
1052862075 9:33443412-33443434 AGCCAGGAAGCACATGGCAAAGG + Exonic
1057064667 9:92037771-92037793 AGTCAGGATGCTCTTGTAAACGG - Intronic
1057076811 9:92142229-92142251 AGCCGGGAGGCCCCAGTAAAGGG - Intergenic
1057765216 9:97910839-97910861 AGCCAGAAAGGCTTTGTAAAAGG - Intronic
1203519178 Un_GL000213v1:30502-30524 AGCCAGCTAGTCCCTGTCAAAGG - Intergenic
1185625939 X:1482237-1482259 AGGCAGGAAGCCACTGTACGTGG + Intronic
1187262450 X:17699253-17699275 AGCCAGGAAAACACTGAAAAAGG + Intronic
1188071219 X:25720454-25720476 GGCTAGGAAGCACCTGCAAAGGG - Intergenic
1189322410 X:40094856-40094878 GGCCAGGACGGCCCTGCAAAGGG + Intronic
1193076615 X:77362562-77362584 AGCCAGGTAGCCCCAGTGGATGG - Intergenic
1194472918 X:94319645-94319667 GGCCATGCAGCCCCTGAAAATGG - Intergenic
1195583852 X:106539702-106539724 AGACAGGGAGCCCCTGGAAAAGG + Intergenic
1196442085 X:115727458-115727480 AGCCAGAAAGCCCCGGGAGATGG + Intergenic
1196442746 X:115730412-115730434 AGCCAGAAAGCCCCGGGAGATGG + Intergenic
1196443477 X:115733456-115733478 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196445801 X:115845376-115845398 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196446472 X:115848357-115848379 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196447141 X:115851338-115851360 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196447812 X:115854321-115854343 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196448480 X:115857300-115857322 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196449151 X:115860291-115860313 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196449822 X:115863282-115863304 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196450491 X:115866265-115866287 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196451161 X:115869250-115869272 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196451832 X:115872229-115872251 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196452503 X:115875216-115875238 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196453173 X:115878185-115878207 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196453843 X:115881178-115881200 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196454510 X:115884187-115884209 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196454923 X:115886289-115886311 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1196455587 X:115889249-115889271 AGCCAGAAAGCCCCGGGAGATGG - Intergenic
1198307872 X:135400485-135400507 ACCCAGGAGGCCCCTGTACCTGG - Intergenic
1199709412 X:150458270-150458292 AGACAGGATGCCCCTCTAGAAGG + Intronic