ID: 1083160806

View in Genome Browser
Species Human (GRCh38)
Location 11:60853006-60853028
Sequence GGTTGCAGCACCGCGGCCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083160806_1083160812 4 Left 1083160806 11:60853006-60853028 CCGGCGGCCGCGGTGCTGCAACC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1083160812 11:60853033-60853055 GCTCACGGCCGCGTGGCTCGAGG 0: 1
1: 0
2: 1
3: 5
4: 84
1083160806_1083160815 27 Left 1083160806 11:60853006-60853028 CCGGCGGCCGCGGTGCTGCAACC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1083160815 11:60853056-60853078 CGATGATCGCCAGCGGCACCAGG 0: 1
1: 0
2: 1
3: 2
4: 38
1083160806_1083160810 -3 Left 1083160806 11:60853006-60853028 CCGGCGGCCGCGGTGCTGCAACC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1083160810 11:60853026-60853048 ACCGCAGGCTCACGGCCGCGTGG 0: 1
1: 0
2: 0
3: 8
4: 51
1083160806_1083160814 20 Left 1083160806 11:60853006-60853028 CCGGCGGCCGCGGTGCTGCAACC 0: 1
1: 0
2: 0
3: 6
4: 92
Right 1083160814 11:60853049-60853071 CTCGAGGCGATGATCGCCAGCGG 0: 1
1: 0
2: 0
3: 1
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083160806 Original CRISPR GGTTGCAGCACCGCGGCCGC CGG (reversed) Exonic
905212701 1:36385639-36385661 GATTCCACCGCCGCGGCCGCCGG + Intronic
907011615 1:50968674-50968696 AGTTGCAGCGCCGCGGGAGCGGG - Exonic
913469074 1:119171921-119171943 GGATCCCGCACCGGGGCCGCAGG - Intergenic
919631019 1:199960036-199960058 GGTTCCCGCACTGGGGCCGCAGG - Intergenic
923790365 1:237106315-237106337 GCTTGCAGCACGGTGGCAGCAGG + Intronic
1069709373 10:70479003-70479025 GGGCGCAGCACGCCGGCCGCAGG + Exonic
1070564017 10:77590225-77590247 GGATCCCGCACCGGGGCCGCAGG + Intronic
1071532479 10:86400651-86400673 GGCTGCAGCCCCACGGCCGCCGG + Intergenic
1075438304 10:122461092-122461114 CGTTGCGGCACCGCGGACCCCGG - Intergenic
1078801061 11:14644273-14644295 GGGAGCAGCGCCGCGGCTGCTGG - Exonic
1078891418 11:15561339-15561361 GGATACCGCACCGGGGCCGCAGG - Intergenic
1080107426 11:28525741-28525763 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1081126861 11:39333013-39333035 GGATCCTGCACCGGGGCCGCAGG + Intergenic
1081488335 11:43548141-43548163 GGTGGCAGCGCCGCGCCTGCAGG - Intergenic
1082817008 11:57515578-57515600 GGCTGAAGCTCCGTGGCCGCCGG - Exonic
1083160806 11:60853006-60853028 GGTTGCAGCACCGCGGCCGCCGG - Exonic
1083664991 11:64269439-64269461 GCTGGCAGCAGCGCGGTCGCTGG - Intergenic
1086397673 11:86433467-86433489 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1096461134 12:51821845-51821867 GGCTGCAGGAGCGCGGCCGGGGG + Intergenic
1097167189 12:57092146-57092168 GATGGAAGCACTGCGGCCGCTGG - Intronic
1100611530 12:96194901-96194923 GGTGGCAGCGACGCGGGCGCAGG - Intronic
1105816883 13:24044139-24044161 GCTTGCAGCACAGCAGCCCCGGG - Intronic
1105957981 13:25301810-25301832 GGCTCCACCACCGTGGCCGCCGG + Exonic
1113945017 13:114039193-114039215 GGTTGCAGCACAGCGGCCCTGGG - Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1120953083 14:90060623-90060645 GGTGGGAGCACCGCAGCCCCGGG + Intergenic
1122293543 14:100692639-100692661 GGCTGCAGGACAGCAGCCGCAGG - Intergenic
1123474657 15:20581487-20581509 GCTTGCAGCTCAGCGCCCGCGGG + Intergenic
1123643354 15:22418870-22418892 GCTTGCAGCTCAGCGCCCGCGGG - Intergenic
1124818402 15:33019430-33019452 GGATCCTGCACCGGGGCCGCAGG + Intronic
1125516475 15:40323884-40323906 GGCTGCAGCAACGCGGTGGCGGG + Intergenic
1127916511 15:63459463-63459485 GGATCCTGCACCGGGGCCGCAGG - Intergenic
1128453632 15:67821214-67821236 GTTTCCAGCAGCCCGGCCGCGGG - Intronic
1128999336 15:72319798-72319820 GGTTTCAGCACCGCGGACAGCGG - Exonic
1130348017 15:83066898-83066920 GGTCGCGGCGCCGCCGCCGCTGG - Exonic
1131012630 15:89031643-89031665 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1132769173 16:1551448-1551470 GGTGGCAGAAGGGCGGCCGCAGG + Intronic
1132934653 16:2474447-2474469 GGGTGCATCACAGCGGCCCCGGG - Intergenic
1133367460 16:5221954-5221976 GGATTCTGCACCGGGGCCGCAGG + Intergenic
1137442586 16:48509104-48509126 GGATCCCGCACCGGGGCCGCAGG - Intergenic
1138688863 16:58749273-58749295 GGATCCCGCACCACGGCCGCAGG - Intergenic
1139600357 16:67982639-67982661 GGATGCTGCACCGGGGCCGCAGG - Intergenic
1141456275 16:84144768-84144790 GGGTGCAGCGCCGCGGCGGGGGG + Intronic
1149099187 17:52883919-52883941 GGATGCCGCACCAGGGCCGCAGG + Intronic
1149916478 17:60614055-60614077 GGATCCCGCACCGGGGCCGCAGG - Intronic
1151567392 17:74906987-74907009 GGATCCTGCACCGGGGCCGCAGG + Intergenic
1151658150 17:75505139-75505161 GGTTGCCGGACCGCAGCTGCAGG - Intronic
1156150387 18:34234260-34234282 GGATCCAGCACAGGGGCCGCAGG - Intergenic
1157856833 18:51111787-51111809 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1160830679 19:1103720-1103742 GTTGACAGCAGCGCGGCCGCAGG - Intergenic
1167095430 19:47372845-47372867 CGCGGCAGCACGGCGGCCGCTGG + Exonic
1167942965 19:52962468-52962490 CGTTGCAGCCCCGCAGCCCCAGG - Intronic
1168296020 19:55377663-55377685 GGTAGCAGCACCGGAGACGCAGG - Exonic
927942121 2:27111457-27111479 GGATCCTGCACCGGGGCCGCAGG + Intronic
933060769 2:77734723-77734745 GGATCCGGCACCGGGGCCGCAGG + Intergenic
933506386 2:83181416-83181438 GGATCCCGCACCGGGGCCGCAGG - Intergenic
941978909 2:171434052-171434074 GGCGGCAGCACCGCGCCCCCAGG + Intronic
943790104 2:191922004-191922026 GGATCCCGCACCGGGGCCGCAGG - Intergenic
947931984 2:233972412-233972434 GGATCCCGCACCGCGGCTGCAGG + Intronic
1173856040 20:46251389-46251411 GGTGGCCTCAGCGCGGCCGCCGG + Exonic
1180979917 22:19873628-19873650 GGCGGCAGGACGGCGGCCGCGGG + Intergenic
1181077601 22:20392354-20392376 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1182278656 22:29205909-29205931 GTTTCCAGCTCCGCGGCCGGAGG - Exonic
953002963 3:38951568-38951590 GGATCCCGCACCGGGGCCGCAGG - Intergenic
956632672 3:71331514-71331536 GGATCCCGCACCGGGGCCGCAGG - Intronic
966852230 3:184171282-184171304 GGTTGCAGGACTGAGGCAGCAGG - Exonic
968552323 4:1229964-1229986 GGTTGGAGCACCTCGGCTGCAGG + Intronic
970386386 4:15561058-15561080 GGTTGCAGCACCACAGCTGGTGG + Intronic
973041732 4:45477294-45477316 GGATCCTGCACCGGGGCCGCAGG + Intergenic
973613543 4:52658857-52658879 GGGCGCAGCAGCGCGGCCCCGGG + Intronic
975045610 4:69799554-69799576 AATTGCAGCACCGTGGCCCCAGG + Intergenic
977606845 4:98993424-98993446 GGTTCCCGCACTGGGGCCGCAGG + Intergenic
986330859 5:6714750-6714772 GGTGTCTGCACCGCGGGCGCCGG - Intronic
1002029332 5:176416430-176416452 GGTGACAGCGTCGCGGCCGCCGG - Exonic
1002524355 5:179807014-179807036 GGCCGCAGCACCGCCGTCGCCGG + Intronic
1003926390 6:10881768-10881790 GCTTCCTGCACCGCGGCCGCCGG + Exonic
1004193871 6:13487270-13487292 GGCTGCGGCGGCGCGGCCGCGGG - Exonic
1004694254 6:18019619-18019641 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1004906280 6:20239431-20239453 GGATCCGGCACCGGGGCCGCAGG - Intergenic
1005712083 6:28512204-28512226 GGATGCCGCACCACGGCCGCAGG - Intronic
1005978157 6:30816240-30816262 GGATCCAGCACCGGGGCTGCAGG + Intergenic
1009853790 6:69233040-69233062 GGTTTCAGCACCTCCGGCGCTGG + Intronic
1011813064 6:91155289-91155311 GGATGCAGCACCACGGCTGAGGG - Intergenic
1011974834 6:93283023-93283045 GGATCCCGCACCGGGGCCGCAGG - Intronic
1018696120 6:166393294-166393316 GGATCCTGCACCGGGGCCGCAGG + Intergenic
1019577974 7:1746649-1746671 GCCCGCAGCACGGCGGCCGCGGG - Exonic
1021567453 7:22029057-22029079 GGATCCAGCACTGGGGCCGCAGG - Intergenic
1023023054 7:36028012-36028034 GGGGGCAGCACCGAGGCAGCTGG - Intergenic
1024113799 7:46173367-46173389 GGTTACAGAACCACGACCGCTGG + Intergenic
1027674552 7:81142156-81142178 GGATCCCGCACCGGGGCCGCAGG - Intergenic
1033866573 7:145697355-145697377 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1043073269 8:75665408-75665430 GGATCCCGCACCGGGGCCGCAGG + Intergenic
1045691017 8:104759862-104759884 GCTTGCAGAACAGCGGCCCCTGG + Intronic
1053393511 9:37752341-37752363 GGATCCAGCACTGGGGCCGCAGG - Intronic
1055814082 9:80185234-80185256 GGATCCAGCACCAGGGCCGCAGG + Intergenic
1057726982 9:97574591-97574613 GGATCCTGCACCGGGGCCGCAGG - Intronic
1060481277 9:124017973-124017995 GGTTTGCGCGCCGCGGCCGCGGG + Intronic
1061015975 9:127980933-127980955 GGCTGCAGCGTCGGGGCCGCAGG - Intergenic
1198468173 X:136921780-136921802 GGATCCTGCACCGGGGCCGCAGG - Intergenic