ID: 1083161087

View in Genome Browser
Species Human (GRCh38)
Location 11:60854491-60854513
Sequence ATGGAGTAAGTGAATGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 302}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083161087 Original CRISPR ATGGAGTAAGTGAATGAACA GGG (reversed) Intronic
900735781 1:4298634-4298656 ATGGAGTGGGTGAATGAGGAGGG + Intergenic
901178020 1:7318856-7318878 ATTCAGTGAATGAATGAACAAGG + Intronic
903175571 1:21578151-21578173 TTGGAGTGAGTGAGTGAGCAAGG - Exonic
903379030 1:22884196-22884218 ATGGAGCCTGTGAATGAAAAAGG + Intronic
903409532 1:23129782-23129804 ATGCAGAAAATGAATGAACTGGG - Intronic
903856430 1:26340196-26340218 AATGAGTGAGTGAATGAAAATGG - Intronic
904290005 1:29478690-29478712 ATGGAGCAGGTGAACGCACAGGG + Intergenic
904588550 1:31594093-31594115 ATGGAGGAAGCGAATGAATGTGG + Intergenic
906146193 1:43562040-43562062 ATGGAGAATGTGCATGCACAGGG - Intronic
906951425 1:50337072-50337094 ATGAAGTAAATGAATAAATATGG + Intergenic
907263694 1:53240916-53240938 ATGGTGTAACTGAAAGAGCATGG + Intergenic
907583783 1:55596099-55596121 TTAGAGTAAGTGAATTAAGAAGG - Intergenic
908207855 1:61869710-61869732 AGGGAGTGTGTGAGTGAACAAGG + Intronic
908341326 1:63182674-63182696 TTGGAATAAGTGGATGAACCTGG + Intergenic
908448011 1:64220361-64220383 ATGGAGTAAGAAACTGAAAATGG - Intronic
909805825 1:79873260-79873282 AGGGAGGAAATGAGTGAACATGG + Intergenic
910683115 1:89888166-89888188 CTGAAGAAAGTGAATGAAAAAGG + Intronic
911199920 1:95034022-95034044 GTGGCTCAAGTGAATGAACAAGG - Intronic
912977144 1:114341159-114341181 ATGGAGGAAGGGAGTGAAGATGG - Intergenic
915532465 1:156510658-156510680 ATGGAGGAAGTGACAGAAAAAGG - Intergenic
916167390 1:161976272-161976294 AATGAATAAATGAATGAACAAGG - Intergenic
917191918 1:172427073-172427095 ATTGGGAGAGTGAATGAACAAGG - Intronic
917379358 1:174386840-174386862 AGTGAGTAAGTGAATAAACTAGG + Intronic
918358187 1:183725601-183725623 ATGGAGTCAATGAATCAATAAGG + Intronic
919619054 1:199844320-199844342 AGGGAATAAATGACTGAACAAGG + Intergenic
919778728 1:201209673-201209695 ATGGGGTCAGTGAATGAAGCAGG + Exonic
919778831 1:201210105-201210127 ATGGGGTCAGTGAATGAAGCAGG + Exonic
919778903 1:201210429-201210451 ATGGGGTCAGTGAATGAAGCAGG + Exonic
920982493 1:210851277-210851299 AATGAGAAAGTGAAAGAACAAGG - Intronic
923247574 1:232147458-232147480 AAGGAGGAAGTGAAGGAAGAAGG + Intergenic
923564290 1:235065097-235065119 ATGGGGTAAGGAAATGAAGATGG + Intergenic
1062781956 10:220275-220297 ATGTAGTAACCAAATGAACAAGG - Intronic
1062784867 10:255768-255790 ATGGAGTGAGTGAAGTGACAAGG + Intergenic
1064305973 10:14166887-14166909 ATTGACTGAGTAAATGAACAAGG - Intronic
1064614261 10:17136141-17136163 ATTGAGTAAGAGAATAATCAGGG + Intergenic
1064726254 10:18282725-18282747 ATATACTAGGTGAATGAACAAGG - Intronic
1065450276 10:25849329-25849351 ATTGATTAAGTGATGGAACACGG + Intergenic
1065731172 10:28711021-28711043 ATGGACAAAGTGAATGAACTTGG + Intergenic
1068489846 10:57709441-57709463 ATGAAGAAAGTGAATTATCAAGG + Intergenic
1069179282 10:65336287-65336309 AAGAAATAAGTGATTGAACATGG - Intergenic
1070538984 10:77402582-77402604 AAGGAGTGAGAGAATGAACGTGG - Intronic
1071994103 10:91130057-91130079 ATGGAGTGAGTGAATGGAAAAGG + Intergenic
1073411283 10:103344104-103344126 ATGGTGAAAATGAATGAACTAGG + Intronic
1073868005 10:107827419-107827441 ATTGAGTAAGGCAATGAAAAAGG - Intergenic
1074433936 10:113417756-113417778 ATGGAGGAAGGGCATGAACCGGG + Intergenic
1074980549 10:118616419-118616441 ATGATGTAACTGAATAAACAGGG + Intergenic
1075187810 10:120278535-120278557 AGGGAGTAAGGAAATGATCACGG + Intergenic
1076148720 10:128145982-128146004 ATTGAGTAAATGAATGGAGAAGG + Intergenic
1077164780 11:1130130-1130152 ACGGATTTTGTGAATGAACAAGG - Intergenic
1077168644 11:1156521-1156543 ATTGAGTGAGTGAATGAATGAGG - Intergenic
1078026159 11:7697442-7697464 ATGGAGGGTGTGAATGAACCTGG - Intronic
1078798014 11:14612987-14613009 ATGGAGATAGGGAAGGAACATGG + Intronic
1078825851 11:14929821-14929843 ATTGAGTAAATGAATTAATATGG + Intronic
1080392306 11:31859789-31859811 CTGGAGATAGTGAATCAACATGG - Intronic
1081151480 11:39638436-39638458 ATGGAATAGGTGAATAGACATGG + Intergenic
1081308253 11:41539975-41539997 ATGAAATAAGTGAATGGATAAGG + Intergenic
1083058053 11:59842250-59842272 GAGGAGTAAGTGAAGGAAGAGGG - Intronic
1083161087 11:60854491-60854513 ATGGAGTAAGTGAATGAACAGGG - Intronic
1083193521 11:61069228-61069250 ATTGAATAAGTGAATGAATCAGG + Intergenic
1085300680 11:75456566-75456588 AAGGGTTAAGTGAATGAAGACGG + Intronic
1085497673 11:76986553-76986575 ATATAGTAAGTGATTGAAAATGG - Intronic
1086540336 11:87901345-87901367 ATGGAGTCAGTGAATAAAATAGG - Intergenic
1086557087 11:88123345-88123367 ACTGAATAAATGAATGAACAAGG + Intronic
1086605577 11:88692389-88692411 AGTGAGTAAATGAATGAACTAGG + Intronic
1086621203 11:88888374-88888396 ATAGAGAAAGTGAAGAAACAGGG + Intronic
1087147406 11:94825741-94825763 ATGGAGTAATAGAAAGAAGAAGG + Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088342877 11:108788911-108788933 ATGGAGCCAGTGACTGGACAGGG - Intronic
1088986084 11:114909773-114909795 ATGGGATAACTGGATGAACAAGG - Intergenic
1089724797 11:120466649-120466671 TTGGCATAAGTGAATGAACAAGG - Intronic
1091289933 11:134433636-134433658 ATGGAGTCAATGAGTGAATAAGG + Intergenic
1092822033 12:12361688-12361710 AGGGACTAAGTGAATGAATGAGG + Intronic
1092860341 12:12714753-12714775 ATGGAGTCCCTGAAGGAACAGGG - Intergenic
1093336697 12:17913190-17913212 ATAGAATAAGTGCATGAACAAGG + Intergenic
1093730930 12:22564933-22564955 ACTGTGTAAGTTAATGAACATGG - Intergenic
1093907993 12:24714481-24714503 CTGGAGTAAGGAAATGAACAAGG - Intergenic
1093982745 12:25492899-25492921 ATGGAATAAAAGAAGGAACAAGG - Intronic
1095744999 12:45648225-45648247 ATGGAGTAACCGAAAGCACAAGG + Intergenic
1098278362 12:68836523-68836545 ATAGAGTAAGTGAGTGTAAAGGG - Intronic
1098485829 12:71020624-71020646 ATGGAGTATATGCATGAATATGG + Intergenic
1098517434 12:71393778-71393800 ATGGAGTAAGTACATTAACCCGG - Intronic
1099510024 12:83523502-83523524 ATAAATGAAGTGAATGAACAAGG + Intergenic
1099715913 12:86293807-86293829 ATGGAGTGAGTGAATGCAGGAGG - Intronic
1099974273 12:89530004-89530026 TTGGAGGAAGTGTATCAACAAGG - Intergenic
1100480894 12:94977882-94977904 ATGGAGTATGAGAGGGAACAGGG + Intronic
1102014735 12:109640477-109640499 ATGCAGTTAGTGACTAAACAGGG + Intergenic
1102426735 12:112849723-112849745 GTTGAGTGAATGAATGAACATGG + Intronic
1102634272 12:114309130-114309152 ATGAATTAAGTGAATGAGCCAGG - Intergenic
1102734209 12:115143731-115143753 CTGAAGGAAGTGAATGAACTAGG + Intergenic
1102899320 12:116624090-116624112 AAGGAGAAAGAGAATGAAGAAGG + Intergenic
1102904642 12:116665154-116665176 AATGAGTGAGTGAATGAAAAAGG - Intergenic
1104104978 12:125650517-125650539 GTGGAATGAGTGAATGAACTGGG + Intronic
1104269457 12:127269555-127269577 AGGGGGTTAGTGAATGAAAAGGG + Intergenic
1104539476 12:129649273-129649295 AAGGAGAAAGTGAAGGAATATGG - Intronic
1105576170 13:21654233-21654255 ATTGAGAAAGTGAATGTGCAAGG + Intergenic
1107044197 13:35977791-35977813 CTGGAGTTAGTGCTTGAACATGG - Intronic
1108333389 13:49413285-49413307 AAGGAGTAAGTGAAAGAAATGGG + Intronic
1108543694 13:51469431-51469453 ATGGAGTCACTAAAAGAACATGG - Intergenic
1109098708 13:58150883-58150905 AAGGAGTCAATGAATGAAAATGG - Intergenic
1110171684 13:72508365-72508387 ATGGATGATGTGAATCAACAAGG + Intergenic
1110475738 13:75911111-75911133 ATGTACTCAGTGAATGATCACGG + Intergenic
1110822818 13:79936266-79936288 ATTGTTTAAGTGAATGGACAGGG - Intergenic
1112784824 13:102940162-102940184 ATTGAGTAAATTAATGAACGAGG - Intergenic
1113355431 13:109575513-109575535 ATGCAGTTAGTGAATAAACAGGG + Intergenic
1115245088 14:31286835-31286857 AGGGAGCATGTGAGTGAACAAGG + Intergenic
1115585293 14:34805364-34805386 AAGGAAAAAGTCAATGAACATGG - Intronic
1115714765 14:36091114-36091136 ATGGAGTAAACAAATGAAGAGGG - Intergenic
1118121359 14:62847726-62847748 ATGGAGTAATAGAACGAATATGG - Intronic
1118635142 14:67741952-67741974 ATGGGGCAAGTGAATCAGCAAGG - Intronic
1120558613 14:85961451-85961473 ATGGTGTGATTCAATGAACAAGG - Intergenic
1121002948 14:90465132-90465154 AGGGAGCTTGTGAATGAACAGGG - Intergenic
1122570674 14:102697585-102697607 ATGAAGTAAGTTAATGTACCAGG - Intronic
1124061177 15:26294847-26294869 GTGGAGTAAGTGAAAGTGCAGGG - Intergenic
1126381907 15:48057217-48057239 ATGGAGGAAGTGATTGAAAGTGG + Intergenic
1126970298 15:54103618-54103640 ATGAATTAAATGAAAGAACAAGG - Intronic
1128674249 15:69597009-69597031 GTCCAGTAAGTGAAAGAACAGGG - Intergenic
1129162871 15:73756757-73756779 ATGGAATAAGATAATGCACATGG + Intergenic
1129932257 15:79421680-79421702 ATGGAGTAAGTGAATGAGGGAGG + Intronic
1131797368 15:96033298-96033320 AGGGAATAAGTGAATTTACAAGG + Intergenic
1131979799 15:97983702-97983724 AAGGCCTAAGTGACTGAACATGG + Intergenic
1133694548 16:8249262-8249284 AGGGAGTGAGTGAAAGAAAAAGG + Intergenic
1134383940 16:13754421-13754443 AAGGAATAAATGAATGATCAGGG - Intergenic
1134419068 16:14069922-14069944 ATGGAGGAAGTGGGTGAAGAAGG - Intergenic
1135333479 16:21581399-21581421 ATGGAGTGAGTGCAAGCACAGGG - Intergenic
1138125985 16:54438926-54438948 ATGAAGTAATTGAATGAATGAGG + Intergenic
1138852039 16:60641193-60641215 ATGGAGCACGTGAGTGAACGAGG + Intergenic
1138881912 16:61026966-61026988 ATGGAGATAGTGAAGGAAAAGGG + Intergenic
1139110310 16:63882271-63882293 TTGGAATAAGTTAATAAACATGG - Intergenic
1139352801 16:66347850-66347872 GTGGAGGCAGTGAATGAAGAGGG + Intergenic
1140141288 16:72260448-72260470 ATGGAATAACTGATGGAACAGGG + Intergenic
1146889460 17:36496758-36496780 AAGGAGTAAGTGAAATGACAAGG - Intronic
1147884461 17:43675501-43675523 CTGGAGGAAGAGAATGAACTTGG + Intergenic
1148318349 17:46724771-46724793 GTTGAGTGAGTGAATGAATAAGG + Intronic
1148567168 17:48640360-48640382 ATGGAATAAGTGAGTCAATAAGG + Intergenic
1149237354 17:54607694-54607716 AGGGAGCATGTGAGTGAACAAGG - Intergenic
1150534066 17:66016911-66016933 ATGTAGTTTGTGAAGGAACAGGG - Intronic
1151813921 17:76461714-76461736 ATGGAGTAAGTGTAAGGACTGGG + Intronic
1153555174 18:6304732-6304754 GTGTATTGAGTGAATGAACAGGG - Intronic
1153732684 18:8030172-8030194 ATGGACTATGTGAATAAAGATGG - Intronic
1154490761 18:14920168-14920190 AACGAATAAATGAATGAACAAGG - Intergenic
1154995949 18:21640522-21640544 ATGGAGTAAGAAAACAAACAGGG - Intergenic
1155366570 18:25055111-25055133 ATGGACTAAATGATTGAAAAAGG + Intergenic
1156080849 18:33333244-33333266 ATAGACTACATGAATGAACATGG - Exonic
1157064233 18:44328934-44328956 ATGGAAACAGTCAATGAACATGG + Intergenic
1157345805 18:46831769-46831791 ATGGTGTAAGATAAAGAACAAGG - Intronic
1158272464 18:55731662-55731684 GTGGAGTAAGGGAATCATCAAGG + Intergenic
1159097767 18:63923873-63923895 ATTGAATAGTTGAATGAACACGG - Intronic
1159652051 18:70988890-70988912 ATTGAGCAAGTGAAGGAGCATGG - Intergenic
1161511479 19:4674715-4674737 ATGGAGCAAGTGGATAAGCAGGG + Intergenic
1162839737 19:13347547-13347569 AGCGCGTAAGTGAATGAGCATGG - Intronic
1163468700 19:17484652-17484674 AGGGAATGAGTGAATGAAGATGG + Intronic
1164234509 19:23320526-23320548 AGGGAGAAAGTGAATAAAGAAGG + Intronic
1164249279 19:23462930-23462952 AGGGAGAAAGTGAATGAAGAAGG + Intergenic
1164320548 19:24140490-24140512 ATATAGTAAGTGACTGAACCTGG - Intergenic
1166001736 19:39881548-39881570 ATGTAGTAACTGTACGAACAGGG - Intronic
1166004518 19:39897799-39897821 ATGTAGTAACTGTACGAACAGGG - Intronic
925296979 2:2783750-2783772 ATAGAGTAAGTGAGTGACCAGGG + Intergenic
926381413 2:12294229-12294251 CTGGAATAAATGAATGAACATGG - Intergenic
926744730 2:16141596-16141618 ATGGAGCAAATGCATGAAGATGG - Intergenic
928026785 2:27746614-27746636 ATGGGGTAAGGGAAGGAGCATGG + Intergenic
928766439 2:34651802-34651824 ATGGTGTAAGTGTATGATCCTGG - Intergenic
930799542 2:55428908-55428930 AGAAGGTAAGTGAATGAACATGG + Intergenic
930883717 2:56300310-56300332 GTTGAATAAGTAAATGAACATGG + Intronic
931482356 2:62654304-62654326 ATGGAGTCAGGAAATGCACATGG + Intergenic
932064901 2:68544737-68544759 ATGGATTTAGTGATTGAAGAGGG + Intronic
932234828 2:70112557-70112579 ATGGAATGAGGGAAAGAACATGG + Intergenic
932269950 2:70400447-70400469 AAGAAGTAAATGAATGAGCATGG + Intergenic
933112002 2:78414032-78414054 TTGGATTAAGTGAAAGAAAATGG + Intergenic
933234474 2:79850136-79850158 AGGGAGGAAGGGAAGGAACAAGG - Intronic
933459986 2:82570243-82570265 AGGGAGGGAGTGTATGAACAGGG - Intergenic
935685938 2:105682751-105682773 ATGAAGTAAGTGAATACAGATGG - Intergenic
935980702 2:108624232-108624254 AAGGAGTAAGTGTAGGTACATGG - Intronic
936605239 2:113945620-113945642 ATGAAGCAAATGAATAAACAAGG - Intronic
936956470 2:118027657-118027679 ATGGAGTTCTTCAATGAACAGGG + Intergenic
939169894 2:138683206-138683228 AAGGAGTAAGTGACTCAGCATGG + Intronic
939388464 2:141533790-141533812 ATGGAGTAAGTTGATGATGAAGG - Intronic
939458276 2:142466036-142466058 AAGGTGTAAGTGAATGTCCAGGG + Intergenic
939528454 2:143326493-143326515 AAAGACTCAGTGAATGAACAAGG - Intronic
939772418 2:146337679-146337701 ACCCAGTAAGTGAAAGAACAGGG + Intergenic
940597209 2:155810473-155810495 AGGGAATAAGTGAGTGAACTAGG - Intergenic
941149348 2:161894427-161894449 AAGGAGTAAGGGAAAGAAAAAGG - Intronic
942187177 2:173435007-173435029 ATGGAGCGAGCGAAAGAACAAGG - Intergenic
946286044 2:218703625-218703647 ATGGATTAAGTGAGTAAAGAAGG + Intergenic
947094984 2:226556064-226556086 GTGGAGTAATTGATGGAACAAGG + Intergenic
947517557 2:230820560-230820582 ATGGAGTTAGTGTAAAAACATGG + Exonic
1169026281 20:2374335-2374357 ATGGAAGAAATGAATGAAGAGGG + Intergenic
1170480742 20:16762528-16762550 ATGGAGAAAGGGAATCACCAGGG - Intronic
1170524839 20:17227168-17227190 ATAGAGAAAGAGACTGAACAGGG - Exonic
1172011215 20:31846927-31846949 ATGGAGTAGGGATATGAACATGG + Intergenic
1172814963 20:37679022-37679044 ATGAAGTAAGTGAAAGACCTGGG + Intergenic
1173145677 20:40522139-40522161 ATGGGGTAAGTGGATGAGCAGGG + Intergenic
1174672661 20:52322628-52322650 ATTGAGTAAGTGGAGGAACTGGG + Intergenic
1176038571 20:63052287-63052309 AGGGAGTGAGTGACTGAAGAGGG - Intergenic
1177893615 21:26835865-26835887 AATGAGTAAGTGAATGGACATGG - Exonic
1178402919 21:32302716-32302738 ATGGAGTAAGGGAATAAGAACGG + Intronic
1179261287 21:39760208-39760230 ATGTACTGAGTGAATAAACATGG - Intronic
1180238688 21:46483053-46483075 ATGGAGTGAGGGGGTGAACAAGG + Intronic
1182861936 22:33567917-33567939 ATGAAGTAAGTGTAGCAACATGG - Intronic
1183933973 22:41251306-41251328 AATGAATGAGTGAATGAACAAGG + Intronic
1184712661 22:46262438-46262460 ATTGGGGATGTGAATGAACAAGG + Exonic
949144284 3:677513-677535 ATTCAGGAAGTGAATGAATATGG - Intergenic
949694600 3:6680138-6680160 AAGCAGTAAGTGGATGAACTGGG + Intergenic
950432193 3:12957266-12957288 ATGAAGAAAGTAAAGGAACAAGG - Intronic
950488277 3:13285582-13285604 ATGGAGACAGAGAATGAGCAAGG + Intergenic
952905663 3:38137907-38137929 AATGAGTAAATGAATGAACCAGG + Intergenic
953004889 3:38969108-38969130 AGGGAGGAAGGGAAGGAACAAGG + Intergenic
953394022 3:42552403-42552425 CTGGAGTAGGTGAATGAACATGG - Intronic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
954065791 3:48104866-48104888 TTGGAGCAGGTGAAAGAACAGGG + Intergenic
954494954 3:50949054-50949076 ATGGTGTAAGGTAAGGAACAGGG - Intronic
955155959 3:56416838-56416860 ATGGATTAAGTCAATAAACATGG - Intronic
955209879 3:56930753-56930775 ATGTAGTAAGTGAAGGGAAATGG + Intronic
956374560 3:68600565-68600587 CTGGACTAAAGGAATGAACAGGG + Intergenic
956554331 3:70501280-70501302 AGGGAGAAGGTGAAAGAACAAGG + Intergenic
959192080 3:103126771-103126793 AAGGAGCAAGTGAAAGAAAAAGG + Intergenic
959478483 3:106841134-106841156 AAGGAGAAAGGGAAAGAACAGGG + Intergenic
960040728 3:113147938-113147960 ATGGAAAAGGTGAATAAACAGGG - Intergenic
960083597 3:113567473-113567495 AGGGACTCAGTGAATGAGCAGGG - Intronic
960939319 3:122923135-122923157 ATGGAGAAAGGGAAAGAACCAGG - Intronic
961554298 3:127687677-127687699 AGGGAGTGAATGAATGAGCAAGG - Intergenic
964116922 3:153146270-153146292 ATGGAGTCTGTGAATGGAAATGG + Intergenic
964411402 3:156401538-156401560 ATGGACTACATGAATGAACTTGG - Intronic
965298580 3:166979950-166979972 ATGGAATAAATGAATGAATAAGG + Intergenic
965631089 3:170733682-170733704 ATTGATTAAGTGACTGAACCAGG - Intronic
966148191 3:176835625-176835647 ATCTAGTTAGTTAATGAACAAGG - Intergenic
967777576 3:193400201-193400223 AAGCAGTAATTGAAGGAACAGGG - Intergenic
968536303 4:1132262-1132284 ATGGGGTAAGTGACAGAAGAGGG + Intergenic
970146736 4:13043894-13043916 AGGCAGTAAGTGAGTGAACTTGG + Intergenic
970998850 4:22299885-22299907 ATGCAGTAAGGCAAAGAACATGG - Intergenic
971096499 4:23410979-23411001 GTGGAAGAAGTGAATGAATAAGG - Intergenic
975358891 4:73442716-73442738 AAGGAGTAAGTGAAAGAAAACGG + Intronic
975394189 4:73855786-73855808 ATGGGGAGAGAGAATGAACAAGG + Intergenic
975430365 4:74282917-74282939 CTGGCCTAAGTGATTGAACATGG - Intronic
976463644 4:85342838-85342860 AGGTAGTAAGTGACTGAACTAGG + Intergenic
976510992 4:85910008-85910030 ATGGAGTGTGTGAGTGAGCATGG + Intronic
977467958 4:97405275-97405297 ATGTACTAAGTACATGAACAAGG + Intronic
978937761 4:114399153-114399175 AGGGAGCACGTGAGTGAACAAGG + Intergenic
978979708 4:114928492-114928514 TTGGAGTAAGTGAAAGAAAATGG - Intronic
981106692 4:140889751-140889773 AAGGAGTTAGAGAATGACCAGGG - Intronic
981286799 4:143026887-143026909 ATGGAGTCAGTGATTGGAAAGGG + Intergenic
983018017 4:162639319-162639341 AATGTGTAAGTGAATGAACTTGG + Intergenic
984489341 4:180412924-180412946 ATTGAGGAAGTTAATGAAAAGGG + Intergenic
985143234 4:186864408-186864430 AATGAATAAATGAATGAACATGG + Intergenic
986540858 5:8842275-8842297 ATGGAATAAGTGAATGCTGAAGG - Intergenic
986909776 5:12541373-12541395 AGGGCGTAAGTAGATGAACATGG + Intergenic
988396642 5:30704399-30704421 GGGGAGTAGGTGTATGAACAGGG + Intergenic
988435925 5:31175301-31175323 ATGAAGTAAGGAAATAAACATGG - Intergenic
989008191 5:36839072-36839094 ATGGATTAAGTGAAATAAAATGG - Intergenic
990056773 5:51591410-51591432 ATGGAAAAAGTGAATAAAGATGG + Intergenic
990473569 5:56140598-56140620 ATTGAGTAAATAAATGAACGAGG + Intronic
990644362 5:57826990-57827012 ATTGAGTTAGAGAATGAAAAAGG - Intergenic
991537415 5:67686182-67686204 ATGGAGGAAGTGAAGCAAGATGG - Intergenic
992452519 5:76886517-76886539 ATGGAGTGAGGGCAAGAACAGGG + Intronic
992618559 5:78570036-78570058 AAGAATTATGTGAATGAACATGG - Intronic
993725769 5:91364931-91364953 ATGAAATAAATGAATGAATATGG - Intergenic
993954766 5:94218681-94218703 ATGGAGTAAGTTCATGGACAAGG - Intronic
995084421 5:108090583-108090605 AATATGTAAGTGAATGAACATGG + Intronic
996295690 5:121913135-121913157 ATGAAATTAGTGAATGAAAAAGG - Intergenic
996450705 5:123620481-123620503 AATGTGTAAATGAATGAACATGG + Intergenic
996763541 5:127011277-127011299 ATGCTGGAAGTGAATGAATAAGG + Intronic
999405210 5:151300943-151300965 ATGGAGGAAATGTATGGACATGG - Intronic
1000237919 5:159379963-159379985 AGGGAGGAGGTGTATGAACAGGG + Intergenic
1000469827 5:161627553-161627575 ATGGAGGAAGGGAATGAGGACGG - Intronic
1000753428 5:165125755-165125777 ATGAAGTAAGTGAATGATACAGG - Intergenic
1001561295 5:172670597-172670619 AATGAGTGAGTGAATGAACCTGG - Intronic
1002139403 5:177129829-177129851 ATGGAATTAATGAATGAAAAGGG + Intergenic
1003285790 6:4732858-4732880 ATGGAGTATTTGGCTGAACAGGG + Intronic
1004271157 6:14196904-14196926 AGTGAGCAAGTGACTGAACATGG + Intergenic
1008206213 6:48661367-48661389 AGTATGTAAGTGAATGAACATGG + Intergenic
1009433854 6:63595720-63595742 ATGGTGAAAGTGAAGGAACATGG + Intergenic
1010202937 6:73298988-73299010 AGAGAGTAAGTGAATGAAGGGGG + Intronic
1011108294 6:83807472-83807494 ATGGAATATGTGAATGAAATGGG - Intergenic
1011992011 6:93533393-93533415 ATGAATTAGGAGAATGAACATGG - Intergenic
1012767723 6:103389167-103389189 TAGGAGTAAGTCAATGAAAAAGG - Intergenic
1012877896 6:104751081-104751103 ATTGAGTGAATGAATGAACTAGG - Intronic
1014145087 6:117988193-117988215 ATTTATTAAGTGAATGAACTTGG + Intronic
1015877932 6:137842985-137843007 ATGGAGTAAGTGAAAAATAATGG + Intergenic
1015976302 6:138794850-138794872 ATGAACCAAGTGAATAAACAAGG - Intergenic
1016201709 6:141418370-141418392 ATCGATTAAGTGAATCAGCATGG + Intergenic
1016568186 6:145481934-145481956 ATTGACTTAGTGAATGACCATGG - Intergenic
1016917813 6:149261059-149261081 TTGGAGAAAGTGGATGAAAAAGG - Intronic
1023649077 7:42349812-42349834 ATTGTGTATGTGAATGAAAAGGG + Intergenic
1024964109 7:55006269-55006291 ATGGAGTATCCAAATGAACAGGG - Intergenic
1026286816 7:68970628-68970650 ATGGAGTAAGGAAATCCACAAGG + Intergenic
1027057161 7:75057705-75057727 GTGGAGTGAATGAATGAACTAGG - Intronic
1028069144 7:86428712-86428734 AAGGACCAAGTGAATGACCAAGG - Intergenic
1029670822 7:102029522-102029544 AGGGAGTGAGTGAATGAAGGAGG + Intronic
1030152129 7:106418263-106418285 ATGGCATAAGTGAATAAACCAGG - Intergenic
1030324160 7:108202586-108202608 ATGGAATAAGTAAATGAAGAGGG - Intronic
1031044217 7:116869445-116869467 ATTTAGTAAATGAATGAAGATGG - Intronic
1031258943 7:119491845-119491867 ATGGAGTAAGTGCATGATATTGG + Intergenic
1031312696 7:120218464-120218486 AGGGAGTAAGGGAAGGAAGAAGG + Intergenic
1031371024 7:120966669-120966691 CTGGAGTATGTGAATGAGCATGG - Exonic
1031541151 7:122996039-122996061 ATGCAGGACGTGAATGAACAGGG - Intergenic
1032663509 7:134012040-134012062 ATGGATGAAGTGAGTGAGCAGGG + Intronic
1033447709 7:141436910-141436932 ATGGAGTAAGTGCAAGAAAGGGG + Intronic
1037338885 8:17820712-17820734 ATTGAGTAAGGGAATGAAGACGG - Intergenic
1037772219 8:21809137-21809159 AAGGAGTAAGTGAATAAGCTAGG + Intronic
1038898081 8:31810207-31810229 ATAGAGTAAGTGAAAGATGATGG - Intronic
1039685790 8:39801003-39801025 ATGGAGTAATTGACAGAAGATGG - Intronic
1043085741 8:75828923-75828945 ATGAAGTCACTGAATCAACAGGG + Intergenic
1044519771 8:93186012-93186034 AAGGTATAAGTGAATGAGCATGG - Intergenic
1045993571 8:108338366-108338388 AGGGAGTGAGTGAATGAAGTGGG + Intronic
1046186903 8:110734048-110734070 AGTGAGTGAGTGAATGAGCACGG + Intergenic
1048544173 8:135370703-135370725 ATGGAGTAAGTGAACCAACATGG + Intergenic
1050433616 9:5586755-5586777 ATGGGGTAAGTGCATGTGCAGGG - Intergenic
1051002124 9:12295630-12295652 ATAGAGTAAGAGAAAGAAAATGG + Intergenic
1051433892 9:17010133-17010155 ATGAAGTAAGTGAATGCATAGGG - Intergenic
1052989217 9:34508990-34509012 AATGAGTAAGTGAATGAATAAGG - Intronic
1055134483 9:72812217-72812239 ATGGAGTTAGCAAATGAACTGGG + Intronic
1055874658 9:80927634-80927656 ATGATGTAAGAGAATAAACAGGG - Intergenic
1056801355 9:89694276-89694298 ATGCAGAAACTGGATGAACAGGG + Intergenic
1058079099 9:100682879-100682901 CTGGAATAACTGAATAAACATGG + Intergenic
1058385648 9:104431920-104431942 CTGGAGTGAGTCAATGACCATGG - Intergenic
1058728658 9:107827957-107827979 ATGGAATAACAGAATGTACATGG - Intergenic
1059187894 9:112293227-112293249 AAGGAGGAAATGAATGAAAAAGG + Intronic
1060603554 9:124894692-124894714 CTGGGGTAACTGAATGAATAGGG - Intronic
1061392733 9:130326921-130326943 TGGGAATAAGTGAATGAGCAAGG + Intronic
1062083874 9:134638598-134638620 ATGGAGGAGGTGGAGGAACAAGG - Intergenic
1062201655 9:135306084-135306106 AGGGAGGAAGAGAAAGAACACGG - Intergenic
1062471180 9:136705772-136705794 AAGGAGGAAGTCCATGAACAAGG - Intergenic
1185774487 X:2791578-2791600 ATGGAGTACGGGAATGCAGAGGG - Intronic
1186361643 X:8848568-8848590 ATGCTGTAACAGAATGAACAGGG - Intergenic
1188373786 X:29402340-29402362 ATGGAGTACGTGCCTCAACAAGG - Intronic
1188502128 X:30838639-30838661 ATTCAGTCAGTTAATGAACATGG + Intronic
1188653278 X:32658467-32658489 ATACATTAAGTGAATAAACATGG + Intronic
1193810057 X:86040426-86040448 AGGGAGCACGTGAGTGAACAAGG - Intronic
1194004732 X:88476823-88476845 GTGGATAGAGTGAATGAACAAGG - Intergenic
1196717892 X:118827607-118827629 CTGGAGCACGTGAAGGAACATGG + Intergenic
1199741672 X:150741458-150741480 ATGGGGTAGGGGAAGGAACAGGG - Intronic