ID: 1083162994

View in Genome Browser
Species Human (GRCh38)
Location 11:60867221-60867243
Sequence GGTGAGAGGGAGACAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083162985_1083162994 12 Left 1083162985 11:60867186-60867208 CCTGTTGGGGCAGGAAGGGAATG No data
Right 1083162994 11:60867221-60867243 GGTGAGAGGGAGACAGTGGAGGG No data
1083162981_1083162994 21 Left 1083162981 11:60867177-60867199 CCTGGAGAGCCTGTTGGGGCAGG No data
Right 1083162994 11:60867221-60867243 GGTGAGAGGGAGACAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083162994 Original CRISPR GGTGAGAGGGAGACAGTGGA GGG Intergenic
No off target data available for this crispr