ID: 1083167402

View in Genome Browser
Species Human (GRCh38)
Location 11:60899199-60899221
Sequence GGCCTGTCACAGCACTCTCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 129}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083167396_1083167402 28 Left 1083167396 11:60899148-60899170 CCTGATCATCGGAGGAGCTCAGG 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1083167402 11:60899199-60899221 GGCCTGTCACAGCACTCTCATGG 0: 1
1: 0
2: 1
3: 14
4: 129
1083167401_1083167402 -4 Left 1083167401 11:60899180-60899202 CCAGTGGCATGAAGGCTGAGGCC 0: 1
1: 0
2: 1
3: 27
4: 236
Right 1083167402 11:60899199-60899221 GGCCTGTCACAGCACTCTCATGG 0: 1
1: 0
2: 1
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083167402 Original CRISPR GGCCTGTCACAGCACTCTCA TGG Exonic
900396731 1:2456164-2456186 GGCCTGTCACAGGGCTATCAGGG + Intronic
900594698 1:3475402-3475424 GGCCTTTCACAGCGCTGACAGGG + Intronic
900594711 1:3475462-3475484 GGCCTTTCACAGCGCTGACAGGG + Intronic
900594724 1:3475522-3475544 GGCCTTTCACAGCGCTGACAGGG + Intronic
900594737 1:3475582-3475604 GGCCTTTCACAGCGCTGACAGGG + Intronic
900594750 1:3475642-3475664 GGCCTTTCACAGCGCTGACAGGG + Intronic
900594763 1:3475702-3475724 GGCCTTTCACAGCGCTGACAGGG + Intronic
901331531 1:8413160-8413182 GGGCTGTTACAGGACTCTAAGGG + Intronic
902537452 1:17128386-17128408 TCCCAGTCACAGCTCTCTCAAGG - Intergenic
905508099 1:38496163-38496185 GGACTGTCTCAGCCATCTCAGGG - Intergenic
906460294 1:46031210-46031232 GGCCTGTCACTGAACACTCAGGG + Exonic
906949799 1:50325324-50325346 GGCCTGTAACAGCACTCTCTTGG + Intergenic
907482905 1:54757051-54757073 TGCCTGTCACACACCTCTCATGG + Exonic
909890128 1:80994991-80995013 TCTCTGGCACAGCACTCTCATGG + Intergenic
915953993 1:160208157-160208179 GGCTTCTCAAAGCACTCCCAGGG + Intronic
917660848 1:177175408-177175430 GGCTGGTCACAGCTCTCTCCTGG - Intronic
917932388 1:179831881-179831903 GCCCTGTCACAGCACTGTCGTGG + Intergenic
918796489 1:188904418-188904440 GGCCTGTCCCAGCACACTTGTGG + Intergenic
919749253 1:201026314-201026336 GTCCAGTCAGAGAACTCTCAGGG - Intergenic
919923075 1:202177718-202177740 TGCCTGGCACAGCACTGACAGGG - Intergenic
920701230 1:208219333-208219355 GGCCTGTTCCATCACTATCATGG + Intronic
920791843 1:209100455-209100477 GTCCTTTCACAGCACACGCAGGG + Intergenic
921776090 1:219101918-219101940 GGCCTGGCAAAGCTCTCTCGTGG + Intergenic
1065881220 10:30039255-30039277 TGCCTGTGACAACACCCTCAGGG - Intronic
1067251461 10:44590215-44590237 GACCTGTCACTCCACTCACAGGG + Intergenic
1070271633 10:74962098-74962120 AGGCTGGCACAGCACACTCAAGG - Intronic
1070708278 10:78657453-78657475 TACCTGTCTAAGCACTCTCAGGG - Intergenic
1071390870 10:85174307-85174329 AGCATGGCACAGGACTCTCATGG - Intergenic
1074494348 10:113966585-113966607 GGTCTGTCACAGAGCTTTCAAGG + Intergenic
1076486271 10:130820581-130820603 GGACAGTCACAGCACACTCTTGG + Intergenic
1082299410 11:50488282-50488304 GGTCTCCCACAGCACTCCCAGGG - Intergenic
1082816457 11:57513039-57513061 AGACTCTCACAGCACTCCCACGG + Intronic
1083167402 11:60899199-60899221 GGCCTGTCACAGCACTCTCATGG + Exonic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1085038411 11:73313092-73313114 TCCCTTTCCCAGCACTCTCATGG + Intronic
1090280600 11:125452886-125452908 GGGCTGTCAAAGGAGTCTCAAGG + Intronic
1092065555 12:5587505-5587527 GGCCCCTCACAGCCCTGTCATGG - Intronic
1092093286 12:5821671-5821693 GGCCTGTTACAGGACTTTGATGG + Intronic
1094631345 12:32178391-32178413 GCCCTGTCAAAGTACTCTCCAGG - Intronic
1099633781 12:85186459-85186481 CGCTTGTTACAGAACTCTCAAGG - Intronic
1100390012 12:94139956-94139978 GGCCGGGCACTGCACTCTCCAGG + Intergenic
1102006848 12:109594705-109594727 GGCCAATCACAGCCCTCCCAGGG - Intronic
1102735305 12:115153844-115153866 CGGCTGTCACAGCACAATCAAGG + Intergenic
1103292746 12:119860417-119860439 GGCTTGTTACAGCATTGTCAGGG - Intronic
1103881180 12:124167062-124167084 GGCCTGTCACAGCTGCCTTAGGG + Intronic
1103902675 12:124311525-124311547 GGCCTCTCACTGCAACCTCAAGG - Intronic
1104159318 12:126163367-126163389 GACCTGTCTCAGGACTCTCAGGG + Intergenic
1104382626 12:128321016-128321038 GACCTGTCAGAGCCCTATCAGGG + Intronic
1104550861 12:129755986-129756008 GGCCTGTCACAGGACAAACAGGG - Intronic
1105210292 13:18253354-18253376 GGCCTGTCTCCCCACTCTCTGGG - Intergenic
1105793022 13:23821507-23821529 GACCTGTCACAAGACTCTCTGGG + Intronic
1112127951 13:96490757-96490779 GGCTTTTCACAGCACTTGCAGGG + Intronic
1116189918 14:41651178-41651200 TTGCTATCACAGCACTCTCATGG + Intronic
1117021244 14:51573134-51573156 AGCCTGTCACAGGACTATCAAGG - Intronic
1122139999 14:99657391-99657413 GGCCTGGCACAGGACCCTCTGGG + Intronic
1124639458 15:31387811-31387833 GGCTGGTCACAGCCCTGTCACGG - Intronic
1126498102 15:49314929-49314951 GGCCTGTCACAGGAGCCACATGG + Intronic
1128496300 15:68200480-68200502 GGCCTGACACAGCCATCCCACGG + Intronic
1131897967 15:97054368-97054390 GGCTTGTCACAGCCTTTTCATGG + Intergenic
1135278839 16:21136651-21136673 GGCCTGTCGCTTCACACTCATGG + Intronic
1135660325 16:24291054-24291076 GGCATGTCACTTCACTCTCCTGG + Intronic
1139563366 16:67757744-67757766 CCGCTGTCACAGCACTCCCATGG + Intronic
1139613771 16:68076748-68076770 AGCCAGTCACAGCACTCCCATGG + Intronic
1141453757 16:84124460-84124482 GGTTTTTCACAGCACTCTGACGG + Exonic
1142309478 16:89303992-89304014 GGCCTGACTCAGCACTCTCCCGG + Intronic
1144222660 17:13114084-13114106 AGCCATTCACTGCACTCTCAAGG - Intergenic
1147029205 17:37617287-37617309 GGCCATTGATAGCACTCTCAGGG + Intronic
1150978799 17:70119230-70119252 AACCTGTGACAGCAGTCTCAGGG - Intronic
1151534352 17:74730293-74730315 GGCCTGTGAGATCACGCTCAGGG + Intronic
1152658471 17:81530789-81530811 GGCCTGTCCCAGCAGTGACAGGG + Intronic
1153989719 18:10385508-10385530 AGGCTGTCTCAGCACCCTCAGGG + Intergenic
1157331244 18:46705299-46705321 GGCATGTCACAGCCACCTCAGGG + Intronic
1161061569 19:2217672-2217694 GGCCTGCTACAGCTCTCTCAAGG - Intronic
928327571 2:30332362-30332384 GGCCTGTCACAGCATTCCTGAGG + Intergenic
931795244 2:65702134-65702156 GGTCTGTCACATCACTTTGAGGG + Intergenic
934274771 2:91566896-91566918 GTCCTGTCCCAGCACTGTCCCGG - Intergenic
934731474 2:96661371-96661393 AGCCTGTCACACCACTGCCAGGG - Intergenic
935934096 2:108163097-108163119 GCTTTGTCAGAGCACTCTCAAGG + Intergenic
937362537 2:121239045-121239067 GTCCTGTCACAGCATCCTCAGGG + Intronic
937853372 2:126655841-126655863 GGCCTGGCCCAGCACTGTCGGGG - Intergenic
943205959 2:184896219-184896241 GGCCTCTAACAGAACTCCCAAGG + Intronic
945400480 2:209376131-209376153 GGTATGTCACAGTGCTCTCATGG - Intergenic
948009656 2:234641266-234641288 GGGCTGCCAGAGCAATCTCAGGG + Intergenic
948526162 2:238572022-238572044 GGCCAGTCACTGCATTCTCTGGG - Intergenic
948975144 2:241459313-241459335 GGCCTGGCAGACCACTCTCCTGG + Intronic
1168930533 20:1619798-1619820 GGCCTGTCCCTGGACTTTCAGGG - Intronic
1171291436 20:23985044-23985066 GGCCTGTCTCCCCACTCTCTGGG - Exonic
1179916448 21:44481014-44481036 GACCTGTCACAGCCTCCTCAGGG - Intergenic
1180635938 22:17263113-17263135 GCTCTGTCACGGCCCTCTCAGGG - Intergenic
1180765963 22:18346049-18346071 GGCCTGTCTCCCCACTCTCTGGG + Intergenic
1180780350 22:18516329-18516351 GGCCTGTCTCCCCACTCTCTGGG - Exonic
1180813066 22:18773650-18773672 GGCCTGTCTCCCCACTCTCTGGG - Intergenic
1181199243 22:21207966-21207988 GGCCTGTCTCCCCACTCTCTGGG - Exonic
1181702502 22:24628989-24629011 GGCCTGTCTCCCCACTCTCTGGG + Exonic
1185075458 22:48679851-48679873 GCCCTGCCCAAGCACTCTCAGGG + Intronic
1203227582 22_KI270731v1_random:86940-86962 GGCCTGTCTCCCCACTCTCTGGG + Intergenic
949755383 3:7404226-7404248 GGATTGTTACAGCACTCTCCTGG + Intronic
951980324 3:28558900-28558922 TGCCTGTCACAGTACTTACAAGG + Intergenic
957040382 3:75331629-75331651 GGCCTGGCCCAGGATTCTCAGGG + Intergenic
958578652 3:95987702-95987724 GGCCTGACAAAGCACTCACAAGG - Intergenic
960494185 3:118355221-118355243 AGCCTGTGAAAGCAGTCTCAGGG + Intergenic
961045172 3:123703208-123703230 GGCCTGGCCCAGGATTCTCAGGG + Intronic
961393251 3:126569140-126569162 GGCCTCTCCCAGCCCTGTCAAGG - Intergenic
961463161 3:127065840-127065862 GGCCTGCCCCAGAACTCTCCCGG - Intergenic
963044077 3:141089666-141089688 GGCCTGTGCCAGCAGCCTCAGGG + Intronic
968209266 3:196834394-196834416 GGCCTGTTACAGCACTACGAGGG - Intergenic
968480790 4:832222-832244 GGCCTGTCACAGGAAACCCAAGG + Intergenic
968554844 4:1241716-1241738 GGCCTGGCACTGCAACCTCAGGG - Intronic
976133239 4:81907420-81907442 GGCCTTTTACATCACTCTGAGGG - Intronic
980250751 4:130311575-130311597 GGCCTGTCTCTGCACCCACATGG - Intergenic
981326980 4:143460931-143460953 GCCATGTCACAGCACTCTAATGG + Intronic
985963969 5:3325481-3325503 CGCTGGTCACAGCACTGTCACGG - Intergenic
986469824 5:8062522-8062544 GGCCTTCCTCAGCATTCTCAAGG - Intergenic
998052214 5:139045384-139045406 GGCTTGTTACCTCACTCTCATGG + Intronic
999224119 5:150005871-150005893 GTCCTGTCATTCCACTCTCAGGG - Intronic
1001415768 5:171544010-171544032 GGCAGGTCACTGCACTCTCTGGG + Intergenic
1002133507 5:177095101-177095123 TGCCTGTCACAGCAGTTGCAAGG - Intronic
1007662962 6:43497665-43497687 GGCCTGTGACAGTACTGTCATGG + Intronic
1010253576 6:73733356-73733378 TGACTGTCACAGCACCTTCAGGG + Intronic
1016075249 6:139788262-139788284 TGCGTGTCACAACACTCTGATGG + Intergenic
1018914912 6:168127234-168127256 GGCCTGGGAGAGCACTCTGAGGG + Intergenic
1018955177 6:168404871-168404893 GGGCTGGAACAGCACACTCAAGG + Intergenic
1023258162 7:38332091-38332113 TGCCTGGGACAGAACTCTCATGG + Intergenic
1024299510 7:47876499-47876521 AGACTGTCACAGCCCCCTCAGGG + Intronic
1026583468 7:71636816-71636838 GACCTATCACTGCACTCACATGG - Intronic
1030139253 7:106287911-106287933 GGTCTTTCATAGCACTCTGAGGG - Intergenic
1035870753 8:3133874-3133896 GGCCTGACAGAGCACTTTCTAGG - Intronic
1038219283 8:25592295-25592317 GGCAAGTCACAGGACTCTCTAGG - Intergenic
1039956016 8:42207673-42207695 GGCCTGCCTCAGCTCCCTCATGG - Exonic
1041723750 8:60999315-60999337 GGCCTGTCACACCTCTCCCCAGG - Intergenic
1041791439 8:61700170-61700192 GGCCTTTCAAAGAACTCACATGG + Intronic
1045252195 8:100491520-100491542 GGGCTGTCACAGCACAGGCAGGG + Intergenic
1049336416 8:142089066-142089088 GGCCTGTCCCACCACTTGCATGG + Intergenic
1049748998 8:144274754-144274776 GGCCTGGCAAAGCACCCCCAGGG + Intronic
1057861095 9:98641473-98641495 TACCTGTCACAGCATTCTCATGG + Intronic
1058748635 9:108016967-108016989 GGCCAGTCACAGGGCTCACAGGG + Intergenic
1059124302 9:111668781-111668803 GGCCTTACAAAGCACTTTCATGG + Intronic
1062312745 9:135948051-135948073 GGCCTTGCACAGAACTCTCCAGG - Intronic
1186552902 X:10525737-10525759 AGCCAGACACAGAACTCTCATGG - Intronic
1186874889 X:13807227-13807249 GGACACTCACAGTACTCTCAGGG + Intronic
1190745791 X:53321159-53321181 GCCCTGTCCCCGCTCTCTCACGG + Exonic
1196072259 X:111539093-111539115 GGCCTGTCACACCCCTATCCTGG + Intergenic
1198890653 X:141392111-141392133 TGCTGGTCACAGCACTCTGATGG + Intergenic
1200831469 Y:7691083-7691105 AGCCAGGCACAGCACTCACAAGG + Intergenic
1201383706 Y:13414529-13414551 GGACTGTCACAGCACTCGAATGG + Intronic