ID: 1083170036

View in Genome Browser
Species Human (GRCh38)
Location 11:60918371-60918393
Sequence ATCTGGCAAGGGTCATCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 8, 2: 39, 3: 53, 4: 155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083170029_1083170036 12 Left 1083170029 11:60918336-60918358 CCAGAGGCTGGGAAGTCTAAGGG 0: 1
1: 4
2: 39
3: 325
4: 1437
Right 1083170036 11:60918371-60918393 ATCTGGCAAGGGTCATCCTATGG 0: 1
1: 8
2: 39
3: 53
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083170036 Original CRISPR ATCTGGCAAGGGTCATCCTA TGG Intronic