ID: 1083170036 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:60918371-60918393 |
| Sequence | ATCTGGCAAGGGTCATCCTA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 256 | |||
| Summary | {0: 1, 1: 8, 2: 39, 3: 53, 4: 155} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1083170029_1083170036 | 12 | Left | 1083170029 | 11:60918336-60918358 | CCAGAGGCTGGGAAGTCTAAGGG | 0: 1 1: 4 2: 39 3: 325 4: 1437 |
||
| Right | 1083170036 | 11:60918371-60918393 | ATCTGGCAAGGGTCATCCTATGG | 0: 1 1: 8 2: 39 3: 53 4: 155 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1083170036 | Original CRISPR | ATCTGGCAAGGGTCATCCTA TGG | Intronic | ||