ID: 1083172066

View in Genome Browser
Species Human (GRCh38)
Location 11:60928962-60928984
Sequence TGAGCACCAGGCCACGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 249}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083172057_1083172066 -3 Left 1083172057 11:60928942-60928964 CCAGCCTCCTGACCCTGCGGTGA 0: 1
1: 0
2: 1
3: 22
4: 228
Right 1083172066 11:60928962-60928984 TGAGCACCAGGCCACGGGGATGG 0: 1
1: 0
2: 0
3: 23
4: 249
1083172053_1083172066 24 Left 1083172053 11:60928915-60928937 CCCTCCTGCTTCGGCACAACTTC 0: 1
1: 0
2: 0
3: 18
4: 236
Right 1083172066 11:60928962-60928984 TGAGCACCAGGCCACGGGGATGG 0: 1
1: 0
2: 0
3: 23
4: 249
1083172059_1083172066 -10 Left 1083172059 11:60928949-60928971 CCTGACCCTGCGGTGAGCACCAG 0: 1
1: 0
2: 4
3: 21
4: 202
Right 1083172066 11:60928962-60928984 TGAGCACCAGGCCACGGGGATGG 0: 1
1: 0
2: 0
3: 23
4: 249
1083172058_1083172066 -7 Left 1083172058 11:60928946-60928968 CCTCCTGACCCTGCGGTGAGCAC 0: 1
1: 0
2: 0
3: 14
4: 157
Right 1083172066 11:60928962-60928984 TGAGCACCAGGCCACGGGGATGG 0: 1
1: 0
2: 0
3: 23
4: 249
1083172054_1083172066 23 Left 1083172054 11:60928916-60928938 CCTCCTGCTTCGGCACAACTTCA 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1083172066 11:60928962-60928984 TGAGCACCAGGCCACGGGGATGG 0: 1
1: 0
2: 0
3: 23
4: 249
1083172055_1083172066 20 Left 1083172055 11:60928919-60928941 CCTGCTTCGGCACAACTTCACAG 0: 1
1: 0
2: 0
3: 8
4: 118
Right 1083172066 11:60928962-60928984 TGAGCACCAGGCCACGGGGATGG 0: 1
1: 0
2: 0
3: 23
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083172066 Original CRISPR TGAGCACCAGGCCACGGGGA TGG Intronic
900154252 1:1197730-1197752 GGAGCCCCAGGCCCCGGGCACGG + Exonic
900614928 1:3561198-3561220 TGAGCTCCAGGCAATGGGCAAGG + Intronic
900777948 1:4598857-4598879 TGAGCTCCAGGGCAGGGGGCTGG + Intergenic
901447888 1:9319322-9319344 TGAGCAACATGCCACGGCCAGGG - Intronic
902049155 1:13548240-13548262 TGAGCACCAGGAAGTGGGGATGG + Intergenic
902243117 1:15101776-15101798 TGAGGACCAGGGCACAGGGTGGG + Intronic
902555499 1:17244373-17244395 TGGGCACCAGGACACAGGGATGG + Exonic
903189403 1:21648358-21648380 GGGCCACCAGGCCACAGGGAGGG - Intronic
903959442 1:27047461-27047483 GGGGCAGCAGGCCAAGGGGAAGG + Intergenic
904006333 1:27365154-27365176 TGAGCACCTGGCATGGGGGAAGG + Intronic
904376153 1:30083760-30083782 TGATCAGCAGGGCACGGGGAAGG + Intergenic
905199557 1:36306818-36306840 TGGGAATCAGGGCACGGGGAAGG - Intronic
905490648 1:38340877-38340899 TGAGCACCAGGAAAGAGGGAAGG + Intergenic
905800284 1:40838554-40838576 GGAGCGCCAGGCCGCGGGGCTGG - Exonic
906842699 1:49157273-49157295 TGAGAACATGGACACGGGGAGGG - Intronic
907405573 1:54251633-54251655 TGGGCCCCATGCCTCGGGGAGGG + Exonic
907408323 1:54267669-54267691 GGACCACCAGGCCAAGGGGAAGG + Intronic
910428561 1:87139360-87139382 ACAGCACCAGGCCTCCGGGAAGG - Intronic
922696223 1:227732292-227732314 TGGGCCCCAGGTCACAGGGAGGG + Exonic
923660140 1:235950555-235950577 TGTGCATCGGGCCAGGGGGAAGG + Intergenic
1063801786 10:9588063-9588085 AGAACACTTGGCCACGGGGAGGG - Intergenic
1065152598 10:22837545-22837567 GGAGCTCCAGACCACGGGGCGGG - Intergenic
1065670378 10:28109707-28109729 TGAGCACTTGGCCACGGAGGAGG - Intronic
1065917899 10:30367742-30367764 TGAGCACCAGCCTCTGGGGAGGG - Intronic
1066460443 10:35608234-35608256 GGAGCCTCAGGCCACGCGGAGGG + Exonic
1069077887 10:64057173-64057195 TTAGCACCAGCCCACTTGGATGG - Intergenic
1069510879 10:69041671-69041693 AGTGCACTGGGCCACGGGGAGGG - Intergenic
1071481097 10:86065518-86065540 AGAGCACCTGGCCACAGGGCAGG - Intronic
1071528310 10:86371275-86371297 TCTGCACCATGCCACGGGAAGGG - Intergenic
1073057561 10:100712138-100712160 TCTGCACCAGGCCATGAGGAGGG - Intergenic
1074414095 10:113252004-113252026 TGAGCATTAGGCCAGTGGGAGGG + Intergenic
1076601187 10:131658020-131658042 AGAGGATTAGGCCACGGGGATGG + Intergenic
1076632546 10:131859726-131859748 TGTCCACCAGGTCACTGGGAGGG - Intergenic
1076668171 10:132104613-132104635 TGAGCTCCAGGCCACGGCTCCGG + Intergenic
1076798212 10:132808963-132808985 TGAGGACCAGGGCACAGGGGCGG + Intronic
1077409476 11:2396755-2396777 TCAGCACAAGGCCCCGCGGAAGG - Intronic
1078904479 11:15671351-15671373 AGAGCCCCAGGTCAAGGGGAAGG + Intergenic
1081578269 11:44333318-44333340 AGAGCACATGGACACGGGGAGGG - Intergenic
1083172066 11:60928962-60928984 TGAGCACCAGGCCACGGGGATGG + Intronic
1083364509 11:62133410-62133432 TGCGCACCAGGCCAGGAGGCAGG - Intronic
1084870783 11:72097441-72097463 TGAGCACCAAGTCAGGGAGAGGG + Exonic
1085134999 11:74078652-74078674 TGAGCTCCAGGCCATGAGGTAGG + Exonic
1086490660 11:87355129-87355151 TCAGCACCATGAGACGGGGAAGG - Intergenic
1088892944 11:114059208-114059230 TGAGCACCGGGGTGCGGGGAGGG + Intergenic
1089329238 11:117678268-117678290 TGAGCCCCAGGCTACAGGGTGGG + Intronic
1089759318 11:120711449-120711471 TGATCCCCAGACCAGGGGGATGG - Intronic
1090076167 11:123581316-123581338 GGAGGACCAGGCCAGAGGGAAGG - Intronic
1091766501 12:3123450-3123472 TGAGCCTCAGGCCAAGGGCAAGG - Intronic
1095752733 12:45729449-45729471 CGAGAGCCGGGCCACGGGGAGGG + Intergenic
1098826616 12:75305623-75305645 TCAGCAGCAGGCCGCGGAGAAGG + Intronic
1102897770 12:116612241-116612263 TGTACACCAGGCCTGGGGGAAGG + Intergenic
1103704397 12:122863463-122863485 GGAGCACCATGCCAGAGGGAAGG + Intergenic
1106466408 13:30018018-30018040 TGAGCACTGGGCCAGGGGTAGGG + Intergenic
1108146151 13:47479146-47479168 TGGGCACCAGGCCAGTTGGATGG - Intergenic
1110718446 13:78734010-78734032 AGAGTACCAGGTCATGGGGAAGG + Intergenic
1112183161 13:97104789-97104811 TGAGCTCCAGGGAACGGAGATGG - Intergenic
1113608543 13:111627228-111627250 TGGGCACCAGGCCTGGGGGTGGG + Intronic
1113911631 13:113844079-113844101 AGAGCCCCAGGCCACAGGCAGGG + Intronic
1114037731 14:18645574-18645596 TGGGCACCATGCCTCAGGGAGGG + Intergenic
1116919915 14:50561065-50561087 TCAGCACCAGGCCGAGGGGAGGG + Intronic
1117862811 14:60110438-60110460 TGCCCACCAGGCCACTGGGGTGG - Intronic
1118741614 14:68743627-68743649 TGAGCACCAGGCCCTGTGCAAGG - Intergenic
1118910226 14:70056025-70056047 TGAGCACCAGGGCCCTGGTAAGG + Intronic
1119424239 14:74525280-74525302 TGAGCACCAGGGAAGAGGGAAGG - Intronic
1119722490 14:76900651-76900673 TGTGCACCAGGGCAAGGGGTGGG - Intergenic
1120351780 14:83369965-83369987 AGAACACAAGGACACGGGGAGGG - Intergenic
1122060926 14:99136230-99136252 TGAGCAGGAGGCCAATGGGAAGG + Intergenic
1122077754 14:99246627-99246649 TGCGCCCCTGGCCTCGGGGAAGG + Intronic
1125655071 15:41349591-41349613 TGATCACCAGGCCAGGGACAAGG - Intronic
1125767708 15:42146291-42146313 CCGGCCCCAGGCCACGGGGATGG - Intronic
1127325418 15:57890080-57890102 CAAGCACCAGGCCACAGAGAGGG + Intergenic
1127884950 15:63190237-63190259 TGAGAACCAGGCAACTGGAAGGG + Intronic
1128252400 15:66172368-66172390 TGCCCACCAGGCCACGGAGCAGG - Intronic
1128388303 15:67165799-67165821 TGGGCATCAGGCCTCGGTGAGGG + Intronic
1128929891 15:71694881-71694903 TGTGCACCTGGCCACCAGGATGG + Intronic
1129002186 15:72344057-72344079 TGAGCCCCAGGCACCGAGGAGGG - Exonic
1130102734 15:80906196-80906218 TGAGCACCATGCCCCAGAGATGG - Intronic
1130959451 15:88650053-88650075 GGAGAAGCAGGCTACGGGGAAGG + Intronic
1131172827 15:90190616-90190638 TGAGCACCAGACCCCTGTGAGGG - Intronic
1132206396 15:99988860-99988882 TGAGCACCAGGTCTTGGGCAGGG + Intronic
1132758929 16:1499675-1499697 CGGGCTCCAGGCCATGGGGACGG - Intronic
1132825014 16:1900212-1900234 TGAGCACCAGAACACCGGGCGGG + Intergenic
1133054171 16:3137262-3137284 TGAGCCTCAGGCCAGGGGAATGG + Exonic
1134121058 16:11585759-11585781 AGTGCACCAGGCCAAGGGGAGGG + Intronic
1136543476 16:30942203-30942225 TGAGGTCCAGGGCACGGGGCTGG - Exonic
1137463971 16:48691355-48691377 TATGCACCAGGCCCCGGGGGAGG + Intergenic
1137570584 16:49563752-49563774 TCAGTAGCAGGCCATGGGGAGGG - Intronic
1137668687 16:50266726-50266748 TGAGCCCCAGGGGACGGGGCTGG + Intronic
1139310160 16:66021325-66021347 TGAACACCAGGCTCCAGGGAAGG - Intergenic
1139649521 16:68355360-68355382 TGGGCCCCGGGCCACAGGGAGGG - Intronic
1139966137 16:70746462-70746484 TGTGTGCCAGGCCACGGGCAGGG - Intronic
1140280530 16:73550450-73550472 AGAGGACCTGGCCACAGGGACGG - Intergenic
1141468567 16:84222955-84222977 GGAGAACCAGGCCACGCAGATGG + Exonic
1141592281 16:85077054-85077076 TGGGCACCAGGCCCCTGGAATGG - Intronic
1142199924 16:88756185-88756207 CGGGCACCAGGCCACAGGGAGGG + Intronic
1142299128 16:89246635-89246657 TGAGCACATGGACACAGGGAGGG + Intergenic
1142803824 17:2361410-2361432 TGCGCACCAGGCGAGGGAGAGGG + Intronic
1143485685 17:7252345-7252367 TGTGCGCCAGGGCTCGGGGAGGG + Exonic
1143571125 17:7759337-7759359 TGAGAACCAGCCAACAGGGAAGG - Intronic
1145019048 17:19415857-19415879 TGAGCTGCAGGCCACGGCCAAGG + Exonic
1145370364 17:22302256-22302278 TGAGCAGTAGGCCACTGTGATGG + Intergenic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1148857753 17:50588255-50588277 TCAGAACCAAGCCACGGTGATGG - Intronic
1149026427 17:52032528-52032550 TGAGCAACCGGCCAAGAGGAAGG - Intronic
1149439770 17:56664388-56664410 TGAGCACCAGGAGGTGGGGATGG + Intergenic
1150135554 17:62693075-62693097 TGAGAACCAGGGCACGGGTGTGG + Exonic
1151361024 17:73588966-73588988 TGAGCACCAGGGCAGGGTTAGGG + Intronic
1151493705 17:74447072-74447094 TGAGGACCTGGCCCCGGGCAAGG + Exonic
1151559756 17:74863998-74864020 TGAGCACCAGCCCACAAGGGAGG + Exonic
1151774922 17:76193988-76194010 TGGGAACCAGGCCACAGAGAAGG + Intronic
1152067263 17:78118709-78118731 TGTGCACCTGGCCAGGGGTAGGG - Intronic
1152069635 17:78128345-78128367 CGAGCGCCAGGGCACGGGGAGGG - Intronic
1152472084 17:80495203-80495225 TCAGTCCCAGGCCAGGGGGAAGG + Intergenic
1152638255 17:81438980-81439002 TGTCCACCAGGACACGGGGCTGG - Intronic
1152727779 17:81956165-81956187 TGAGAACCAGGCCAAGGTCATGG - Intronic
1152811488 17:82384796-82384818 TGAGGTCCATTCCACGGGGATGG - Intergenic
1154281450 18:13006893-13006915 TGAACACCTGACAACGGGGAGGG - Intronic
1154306577 18:13234742-13234764 TGAGCAGCAGTCCATGGGGTGGG - Intronic
1156171826 18:34494344-34494366 TGGGCTCCGGGCCCCGGGGACGG + Intronic
1156461373 18:37323148-37323170 TGAGCACAAGGCCAGTGGAAGGG + Intronic
1157182566 18:45510553-45510575 TGATCAGCAGGCAAAGGGGAAGG - Intronic
1158426647 18:57346525-57346547 TGAGGTCCAGGCCAGGGAGAAGG - Intergenic
1159632890 18:70769272-70769294 TGAACACATGGACACGGGGAGGG + Intergenic
1160734476 19:656019-656041 TGAGCACCAGGGCCTGGGGGAGG + Intronic
1160858517 19:1227886-1227908 GGAGCACGAGGCCACGGGCGGGG - Exonic
1160990488 19:1858364-1858386 GGGGCACCAGGCCACTGTGAGGG - Intronic
1161064893 19:2232752-2232774 AGGGCACCAGGCCACAGGCAAGG + Intronic
1161393620 19:4033582-4033604 TGAGCCCGGGGCCCCGGGGAGGG + Intronic
1161406687 19:4094943-4094965 TGTGCCGCAGACCACGGGGAAGG - Intronic
1162071551 19:8155289-8155311 GGGGCCCAAGGCCACGGGGAAGG - Intronic
1163748117 19:19059978-19060000 GGAGGAGCCGGCCACGGGGAAGG - Intronic
1163843621 19:19626840-19626862 TGACCACGCGGCCACGGGGCAGG + Exonic
1164911169 19:32013141-32013163 TGAGCACCTGGCCCCTGGGGTGG + Intergenic
1165087993 19:33364628-33364650 TGAGGACCAAGCCAAGGGGCTGG - Intergenic
1165740755 19:38203891-38203913 GGAGCACCAGGCCAGGGGAAGGG - Intronic
1166293438 19:41877684-41877706 TGAGCACCAGGGCTGGGGGCAGG + Intronic
1166389574 19:42401664-42401686 TGAGACCCTCGCCACGGGGAGGG - Exonic
1167320133 19:48792430-48792452 AGAACACAAGGACACGGGGAGGG - Intergenic
1167529679 19:50007508-50007530 TCAGCACCAGGACAGTGGGAGGG - Intronic
925843954 2:8019126-8019148 TTAGAACCAGGCCACAGGGATGG + Intergenic
927214706 2:20661782-20661804 TGTGCCCCAGGCTACCGGGAGGG - Intergenic
927522468 2:23707678-23707700 TGAGGACCAGGCCAGTGGGAAGG + Exonic
929545473 2:42852681-42852703 AGAGCACAAGGGCACGGCGAGGG + Intergenic
929594710 2:43168880-43168902 AGCTCACCAGGCCAGGGGGAAGG - Intergenic
929895116 2:45953142-45953164 GGACCACCTGGCCATGGGGAAGG - Intronic
931668990 2:64630112-64630134 TAAGCACCAGGCAACTAGGACGG - Intergenic
937150592 2:119683179-119683201 TGAGCTCCAGCCCACAGTGAGGG - Intronic
937227676 2:120379057-120379079 AGAGCCCCAGGCCACGGAGTTGG - Intergenic
938273237 2:129993490-129993512 TGGGCCCCATGCCTCGGGGAGGG - Intergenic
938442981 2:131352609-131352631 TGGGCCCCATGCCTCGGGGAGGG + Intronic
941583784 2:167331756-167331778 TGAGTCCCAGGCCACTGGTAGGG + Intergenic
941959137 2:171236338-171236360 TGAGCACGTGGCCATGGTGAGGG + Intergenic
945197968 2:207255140-207255162 TGTACCCCAGGCCATGGGGAAGG - Intergenic
947611246 2:231526348-231526370 TGTGCACCAGGCCAGGGGCCAGG - Intronic
948643798 2:239391443-239391465 TCAGCAGCAGGCCCCGGGCAGGG + Intronic
948708270 2:239809328-239809350 TGGGCTCCAGGACACAGGGAGGG - Intergenic
948814202 2:240501681-240501703 TGAGCACAACGCCTCGGGCATGG + Intronic
948859211 2:240744837-240744859 TGAGTGCCAGGCCACGGGTGTGG - Intronic
1168997675 20:2145162-2145184 AGAGCAGCAGCCCAGGGGGAGGG - Exonic
1171953623 20:31442566-31442588 TGAACACCAGGGGAAGGGGAAGG + Intronic
1172698864 20:36840456-36840478 AGAACACCAGGCCAAGGGCACGG - Intronic
1172772549 20:37389904-37389926 TGAGGACCAGGCCCGGGGGAAGG + Intronic
1172878640 20:38182395-38182417 TGAGCCCAAGGCTACAGGGATGG - Intergenic
1173553755 20:43951001-43951023 TGGGCTCCAGGCCCCAGGGATGG + Intronic
1174183356 20:48688833-48688855 AGAGCACCAGGCCCAGGGCAGGG + Intronic
1175340146 20:58223727-58223749 TGAACACCAGACAACGAGGAGGG - Intronic
1175526060 20:59634510-59634532 GGAGCAGCAGGCCAGGGTGAGGG - Intronic
1180131953 21:45832584-45832606 TCAGCACGGGGCCACGGGGGTGG - Intronic
1180461860 22:15572616-15572638 TGGGCACCATGCCTCAGGGAGGG + Intergenic
1180732336 22:17991525-17991547 TGACCACCAGCCCAGGGGAAGGG - Intronic
1180899023 22:19357596-19357618 TGACCACCAGGCCCCTGGGTGGG + Intronic
1181517027 22:23420529-23420551 TGACCACCAGCCCAGGGGAAGGG - Intergenic
1181537977 22:23556502-23556524 GGAGCAGCAGGCCACCAGGAGGG + Intergenic
1181752810 22:25001494-25001516 TGTGGACCAGGCCAAGGGGGAGG + Intronic
1182006789 22:26967024-26967046 TGAGTACCAGGCACTGGGGAAGG - Intergenic
1182428694 22:30288134-30288156 TCAGCTCCAGGCCCCAGGGAGGG + Intronic
1184663559 22:45976367-45976389 TGGGCTCCAGGCCCCGGGGGTGG - Intronic
1184679424 22:46062088-46062110 GGAGCACCCGGCCCCGGGGCGGG - Intronic
1185119438 22:48957337-48957359 TGGGCCCCAGGCCACTGTGAGGG + Intergenic
1185122664 22:48981854-48981876 TCAGCACCAGGCCAAGGGAAGGG - Intergenic
949388939 3:3537552-3537574 TGGGCAACAGGCCCCGGGGATGG + Intergenic
950082682 3:10234726-10234748 TGTGCACCAGGCCTCTGCGAAGG - Intronic
952716626 3:36486467-36486489 GGAGCATGAGGCCAAGGGGATGG - Intronic
952902727 3:38120718-38120740 TGAGCCCCAGGACAGGGGCAGGG - Intronic
952927175 3:38328767-38328789 TGAGCCCCAGGACAGGGGCAGGG + Intergenic
953687155 3:45087006-45087028 TGAGCCCCTGGCCAGGAGGATGG + Intronic
954930687 3:54278786-54278808 AGAACACCTGGACACGGGGAGGG + Intronic
955696429 3:61641901-61641923 TGTGCACCAGCCCACAGGAAAGG - Intronic
955977085 3:64489669-64489691 GGAGCACCAGGCCACCTGGGTGG + Intergenic
957377318 3:79375346-79375368 TGACCAGCAGCCCAAGGGGACGG + Intronic
958521906 3:95201483-95201505 AGAACACATGGCCACGGGGAGGG - Intergenic
960872243 3:122261605-122261627 TGAGCACCAGGCCACTGCCATGG + Exonic
960998027 3:123352210-123352232 TGGGCACCAGGCCTTGGGCACGG + Intronic
961370222 3:126424205-126424227 TGAGCACGAGGACATGGGCATGG + Intronic
961402495 3:126657025-126657047 TGTGCACCAGCCCAAGGGGCAGG + Intergenic
961551794 3:127673680-127673702 TCAGCACCAGGTCAAGGGGGAGG - Intronic
962257298 3:133881143-133881165 TGGGCACCAGGGCAAGGAGATGG + Intronic
962375123 3:134852781-134852803 TCAGCACCAGGCCACTGTCATGG + Intronic
962583606 3:136819473-136819495 GGAGAACCGGGACACGGGGACGG + Exonic
965053942 3:163689731-163689753 CCAACACCAGGCCATGGGGACGG - Intergenic
965728383 3:171744543-171744565 TCAGCATTAGGCCACGTGGAGGG - Intronic
968919223 4:3514086-3514108 TGAGCTCCTGCCCACGGGCAAGG + Intronic
969578505 4:8050400-8050422 TGAGCACCTGGCCCCAGGAAAGG - Intronic
979128343 4:117006300-117006322 AGACCACCAGGCCATGGGAAAGG - Intergenic
980071294 4:128245148-128245170 TGAGAACTAGGGCACGGAGAGGG + Intergenic
980173381 4:129316067-129316089 AGAACACCAGGACACAGGGAGGG + Intergenic
982489087 4:156006323-156006345 TGAGCCACAGGCCAGGGTGAAGG - Intergenic
983698249 4:170559389-170559411 TGAGGACGAGACCACGGGGACGG - Intergenic
985477789 5:89662-89684 TGAGCAGCAGGGGACGGGGAGGG - Intergenic
985576997 5:678150-678172 TGAGCACCAGGACGTGGCGAGGG + Intronic
985591917 5:770203-770225 TGAGCACCAGGACGTGGCGAGGG + Intergenic
985965302 5:3335208-3335230 AGTGCATGAGGCCACGGGGAAGG - Intergenic
986285408 5:6354976-6354998 TGTGGACAAGGCCACAGGGAGGG + Intergenic
986286998 5:6366499-6366521 GGACCACCAGGCCATGGGGCAGG - Intergenic
988853922 5:35208108-35208130 TGAGCAGGAGGCCACTGGGGAGG - Intronic
989353825 5:40518544-40518566 AGAGCACCAGGCCTCAGGGCAGG - Intergenic
989592294 5:43122387-43122409 TGAACACCAGACTACGTGGAAGG - Intronic
990987523 5:61654776-61654798 TGAGGACCAGGGCAGGGGGAAGG - Intronic
993148323 5:84125899-84125921 TGAGCAGCAGGTGATGGGGAAGG + Intronic
996396717 5:123021111-123021133 GGAGCACCAAGCCATGGGGACGG - Intronic
997266497 5:132497906-132497928 TGAGCTCCAAGCCCTGGGGAGGG - Intergenic
997979293 5:138459025-138459047 TGAGCCCCTGGTGACGGGGATGG - Intergenic
998265240 5:140663134-140663156 TGAGCACCAGGCCAAAGTGCTGG - Intergenic
999477170 5:151911114-151911136 TGAGCTCAAGGCCACTGGGTAGG - Intronic
999736128 5:154514687-154514709 TGAGGGCCAAGCAACGGGGAAGG - Intergenic
1001052019 5:168421273-168421295 TGCCCACCCGGCCACAGGGAAGG + Intronic
1002298360 5:178243777-178243799 TGAGAACCAGGCCTCCTGGAAGG + Intronic
1003126999 6:3363507-3363529 TGAGCAGCAGGCCATGGGCGGGG - Intronic
1005389768 6:25321236-25321258 TGAGCACCCACCCACGGGGTTGG + Intronic
1006728362 6:36216424-36216446 TGAGTGCCAGGCAACTGGGATGG - Intronic
1013366640 6:109442260-109442282 TGAGCACCATGCCACTTAGATGG - Exonic
1013458609 6:110355495-110355517 TGAGCCCCAGGCCACAGGCTCGG + Intronic
1016603731 6:145893237-145893259 TGAGCTTCAGGCCATAGGGAGGG - Exonic
1016833650 6:148456041-148456063 TGGCCAGCAGGCCTCGGGGATGG + Intronic
1017106875 6:150896327-150896349 TGAGCCCCAGGCCTCAGGGAGGG - Intronic
1017521110 6:155203913-155203935 TGAGGTCCTGGCCACGGGGAGGG + Intronic
1018705696 6:166461889-166461911 TGGGCACCAGGCTCTGGGGATGG - Intronic
1018859071 6:167698149-167698171 TAACCACCAGGCCCTGGGGATGG + Intergenic
1019183328 6:170206820-170206842 GAAGCCCCAGGCCAGGGGGACGG - Intergenic
1019330370 7:457928-457950 TCAGCACCAGGCCTCGGGTGAGG + Intergenic
1019740462 7:2670438-2670460 TGAGGGCAAGGCCACGGGCAGGG + Intergenic
1023406006 7:39834182-39834204 TGGGCCCCATGCCTCGGGGAGGG - Intergenic
1027168132 7:75850576-75850598 TCAGCACCAGGCCATGGGAATGG + Intronic
1032267895 7:130381348-130381370 TGAGCACCTGGGCAAGGGGCCGG + Intronic
1034355705 7:150449442-150449464 TGAAGACCAGTCCAGGGGGAGGG + Intergenic
1035255054 7:157620883-157620905 TGTGTACCAGTCCCCGGGGAGGG - Intronic
1035843340 8:2836161-2836183 TGTGCACCATGCCACGTGCAAGG - Intergenic
1037016289 8:13911019-13911041 GGAGCACGTGGACACGGGGAGGG - Intergenic
1037734007 8:21552502-21552524 TGATGACCAGGCCAGGGAGAGGG - Intergenic
1037855554 8:22368308-22368330 GGAGCCCCAGGCCATTGGGACGG + Intronic
1039892432 8:41694531-41694553 TGAACTCCAGGCCTCCGGGAAGG - Intronic
1040644448 8:49382094-49382116 GGTGCACCTGGCCACGGGGAGGG - Intergenic
1043864642 8:85361123-85361145 TGAGGCTCAGGCCACTGGGAGGG + Intronic
1047001346 8:120575932-120575954 CAAACACCAGGCCAAGGGGATGG - Intronic
1048007377 8:130430529-130430551 TGACCACCTGGGCATGGGGATGG + Intronic
1048323202 8:133417928-133417950 TGGGTACCTGGCCAAGGGGAGGG - Intergenic
1048880340 8:138867346-138867368 TGAGCACCACGTCACAGAGAGGG - Intronic
1049417205 8:142500503-142500525 AGGGGTCCAGGCCACGGGGATGG + Intronic
1049493416 8:142916913-142916935 TGAGCACCCGGCCCAGAGGACGG - Intronic
1049618663 8:143588093-143588115 TGAACACCAGGGCAGGTGGAAGG + Intronic
1049688333 8:143948151-143948173 AGACCACCAGGGCACAGGGAGGG + Intronic
1049755571 8:144309975-144309997 TGAGCACCTGGCCCCGGTCAGGG - Intronic
1051665527 9:19464419-19464441 CGAGCACTAGGCCAGGGGAAAGG + Intergenic
1052003489 9:23317538-23317560 AGAACACAAGGACACGGGGAGGG - Intergenic
1058724396 9:107788134-107788156 GGAGCAACAGGTCAGGGGGAAGG - Intergenic
1060183138 9:121547499-121547521 AGAGCACCAGGCAAAGGGGAGGG + Intergenic
1061170007 9:128947260-128947282 GGAGCCCCAGGCCCCGGGGCCGG + Exonic
1061939572 9:133876735-133876757 TGGGCAGGAGGCCACAGGGATGG + Intronic
1062010329 9:134263611-134263633 TCAGGACCAGGCCACCTGGAGGG + Intergenic
1062096849 9:134708022-134708044 TGAGCAGCAGGGCCCAGGGAAGG - Intronic
1062111612 9:134785147-134785169 GGAGCCCGAGGCCATGGGGAAGG - Intronic
1190333126 X:49247928-49247950 TGAGAATCAGGCCAGGGTGAGGG + Intronic
1200935401 Y:8734090-8734112 TGAACACCGGGCCACGGTGTGGG + Intergenic