ID: 1083173288

View in Genome Browser
Species Human (GRCh38)
Location 11:60935163-60935185
Sequence GGGTGCTCCCAGCACCCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 268}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083173288_1083173295 -4 Left 1083173288 11:60935163-60935185 CCGTGAGGGTGCTGGGAGCACCC 0: 1
1: 0
2: 0
3: 30
4: 268
Right 1083173295 11:60935182-60935204 ACCCGGTTCCCTCTGGGTGGGGG 0: 2
1: 0
2: 1
3: 8
4: 141
1083173288_1083173294 -5 Left 1083173288 11:60935163-60935185 CCGTGAGGGTGCTGGGAGCACCC 0: 1
1: 0
2: 0
3: 30
4: 268
Right 1083173294 11:60935181-60935203 CACCCGGTTCCCTCTGGGTGGGG 0: 1
1: 1
2: 1
3: 14
4: 142
1083173288_1083173301 12 Left 1083173288 11:60935163-60935185 CCGTGAGGGTGCTGGGAGCACCC 0: 1
1: 0
2: 0
3: 30
4: 268
Right 1083173301 11:60935198-60935220 GTGGGGGCTGTCTGTATGGAAGG 0: 1
1: 0
2: 2
3: 26
4: 237
1083173288_1083173291 -10 Left 1083173288 11:60935163-60935185 CCGTGAGGGTGCTGGGAGCACCC 0: 1
1: 0
2: 0
3: 30
4: 268
Right 1083173291 11:60935176-60935198 GGGAGCACCCGGTTCCCTCTGGG 0: 1
1: 1
2: 1
3: 9
4: 97
1083173288_1083173293 -6 Left 1083173288 11:60935163-60935185 CCGTGAGGGTGCTGGGAGCACCC 0: 1
1: 0
2: 0
3: 30
4: 268
Right 1083173293 11:60935180-60935202 GCACCCGGTTCCCTCTGGGTGGG 0: 1
1: 1
2: 0
3: 8
4: 104
1083173288_1083173300 8 Left 1083173288 11:60935163-60935185 CCGTGAGGGTGCTGGGAGCACCC 0: 1
1: 0
2: 0
3: 30
4: 268
Right 1083173300 11:60935194-60935216 CTGGGTGGGGGCTGTCTGTATGG 0: 1
1: 0
2: 3
3: 28
4: 391
1083173288_1083173292 -7 Left 1083173288 11:60935163-60935185 CCGTGAGGGTGCTGGGAGCACCC 0: 1
1: 0
2: 0
3: 30
4: 268
Right 1083173292 11:60935179-60935201 AGCACCCGGTTCCCTCTGGGTGG 0: 1
1: 1
2: 2
3: 9
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083173288 Original CRISPR GGGTGCTCCCAGCACCCTCA CGG (reversed) Intronic
900433137 1:2612250-2612272 GGAGGCCCCCAGCACCCCCAGGG - Intronic
900473611 1:2866149-2866171 GGGTGCTCCAAGCCCCCCCATGG - Intergenic
900983199 1:6058372-6058394 GGTTCCTCCCAGGACACTCAGGG - Intronic
901404979 1:9039531-9039553 GGCAGCTCCCAGGACACTCACGG + Exonic
902198396 1:14815285-14815307 GGGAGCGCCCAGCACCCAGAAGG - Intronic
902207129 1:14877135-14877157 GGGTGTTCCCCGCACTCTCTCGG + Intronic
902214833 1:14927970-14927992 GGGTCCTCCCAGCAACCCAATGG + Intronic
902228439 1:15011938-15011960 TGCTCCTCCCAGCACCTTCAGGG + Intronic
904078844 1:27859206-27859228 GGCTGCTCCTTCCACCCTCAGGG + Intergenic
904378729 1:30097274-30097296 GCCTGCTCCCAGGACCCACATGG - Intergenic
904454352 1:30638427-30638449 AGGTGTGGCCAGCACCCTCAAGG + Intergenic
904882499 1:33711633-33711655 CGAGGCTCACAGCACCCTCATGG + Intronic
906518412 1:46453010-46453032 GTGTGCTCTCACCACACTCACGG - Intergenic
906640514 1:47438245-47438267 GGGAGCTCCCAGCTCGCTCCGGG + Exonic
907311743 1:53542742-53542764 TGGTGCTGTCAGCACCCCCAGGG - Intronic
916996306 1:170305407-170305429 GCCTGCACCCAGCACCCTTATGG + Intergenic
917808900 1:178638539-178638561 GGGTGCCCACAGCACCCCCTCGG + Intergenic
919380117 1:196848606-196848628 GGGTGATGCCAGCACGCTCTTGG + Intronic
919781750 1:201225754-201225776 GGCTGCTACCAGCCCCCTCCAGG - Intronic
919817066 1:201448312-201448334 GGCAGCTCCCAGCACACACAGGG + Intergenic
922250807 1:223846740-223846762 GGGTGTTCCCAGCACCCCCCAGG - Intergenic
1062862684 10:822680-822702 GGGTGGTCCCAGCACCATAGAGG + Intronic
1063510214 10:6637416-6637438 GGGAGCTACCAGCAGCCTCCAGG - Intergenic
1064462268 10:15546538-15546560 GGGTGCTACCAGCACCTACTAGG + Intronic
1065236808 10:23660391-23660413 GAGTGCTCTCAGCTCCTTCAGGG + Intergenic
1066727611 10:38409467-38409489 GGGTGTTACCTACACCCTCAGGG - Intergenic
1067081566 10:43215445-43215467 GGCTGCCCCCAGCTCCCTCCAGG - Intronic
1068009742 10:51433379-51433401 GGGTGCTTCTAGTACCCTCTTGG + Intronic
1069488326 10:68840056-68840078 GTGTGTTCTCGGCACCCTCAAGG - Intronic
1069751020 10:70745041-70745063 CGATCCTCCCAGCACCCTCATGG + Intronic
1070944539 10:80378324-80378346 GGTTGGTCCCAGCAACCTCCTGG - Intergenic
1071418558 10:85464482-85464504 GGGGGAACCCATCACCCTCAAGG + Intergenic
1071603843 10:86971518-86971540 TGGTGTTCCCAGCACCCCCCCGG + Intronic
1072662999 10:97373918-97373940 GTGTGAGCCCAGCACCCTCCTGG + Intronic
1072798008 10:98371592-98371614 TCATCCTCCCAGCACCCTCAGGG + Intergenic
1073295483 10:102435913-102435935 GGGTGCTCCCCTCACTCACATGG - Intergenic
1073890915 10:108099703-108099725 GGTTACTCCCTGCACCCCCATGG - Intergenic
1074983946 10:118641282-118641304 GAGGGCTCCCAGCAGCCTCGGGG - Intergenic
1076049070 10:127318351-127318373 GTGTGATCCCAGCACACTGAAGG + Intronic
1076795564 10:132796535-132796557 GCTTGTTCCCAGCACTCTCAGGG + Intergenic
1077038083 11:504730-504752 GGCAGCTCCCACCACCCTCGAGG + Intronic
1077147191 11:1051581-1051603 GGGTGCTCAGTGCAGCCTCAGGG - Intergenic
1077305891 11:1868559-1868581 GGCTTCCCCCAGCCCCCTCAGGG - Intronic
1077466064 11:2734323-2734345 TGGTGCTCCCCGCCACCTCACGG - Intronic
1080796503 11:35568343-35568365 GGGTGATGCAAGCACTCTCATGG - Intergenic
1081640895 11:44753496-44753518 GGGTGCCCCCAGCATCTTCCTGG + Intronic
1081907522 11:46679123-46679145 GGATGCGGCCATCACCCTCAAGG - Exonic
1083173258 11:60935081-60935103 GGGTACTCCCAGCAGGCTCATGG - Intronic
1083173288 11:60935163-60935185 GGGTGCTCCCAGCACCCTCACGG - Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1083650927 11:64204307-64204329 GGGCCCTCCCAGCACACGCATGG + Exonic
1083853096 11:65379138-65379160 TGCTTCTCCCAGCACCCTCTTGG + Intronic
1083869273 11:65477190-65477212 GGGTCCTCCCACCACCCTCGCGG + Intergenic
1084741966 11:71145920-71145942 GGGTCCTCCCAGCCCACTGAGGG + Intronic
1088626043 11:111731442-111731464 TGGTGCCTCCAGCACCCTGAGGG - Intronic
1089477288 11:118774977-118774999 GGGTGCACCCATCACCCCCCTGG - Intronic
1089677855 11:120102254-120102276 GGGTGCTCCCAGCCTCATCTGGG - Intergenic
1089877802 11:121742383-121742405 GGTTCCTCCCAGATCCCTCAAGG + Intergenic
1090136435 11:124204101-124204123 GGGTGATGCCAGCACTCTCTTGG + Intergenic
1091602375 12:1925597-1925619 GGGTGCTCCCTCCATCCTCCTGG - Intergenic
1092687679 12:11070056-11070078 GAGGGCTCCCACCACCCACAAGG + Intronic
1092764282 12:11838750-11838772 GGGTGCCCACAGCACCCACAGGG - Intronic
1092946445 12:13458455-13458477 GGCACCTCCCAGCACCATCAGGG - Intergenic
1093679794 12:21988665-21988687 GGGTTCTCACAGCACCCTGAAGG - Intergenic
1094653596 12:32400015-32400037 GGGCGCTCCCAGCGCCCTGCAGG + Intronic
1095520032 12:43052606-43052628 GGGTGTTCCCAGAAGACTCAAGG + Intergenic
1095573689 12:43710447-43710469 GGGTGATGCCAGCACTCTCTTGG + Intergenic
1098460933 12:70732384-70732406 GGGAGCTCCTAAAACCCTCACGG - Intronic
1098609954 12:72444347-72444369 AGCTGCACCCAGCACCCTAAAGG - Intronic
1100981445 12:100165855-100165877 AGGTGACCCCAGCACCCTCCAGG - Intergenic
1101642911 12:106601378-106601400 GGGTGGGCCTGGCACCCTCAGGG + Intronic
1102413856 12:112743547-112743569 GTATCCTCCCAGCAGCCTCATGG + Intronic
1102466495 12:113133677-113133699 TGGAGCTCCCAGCAGCCTCCAGG + Intronic
1102585460 12:113919904-113919926 GTGTGCTCACAGCCCCCTAATGG + Intronic
1103676683 12:122661352-122661374 GGGCAGTCCCAGCAACCTCAGGG - Intergenic
1104968933 12:132522432-132522454 GGTTACTGCCAGAACCCTCAGGG + Intronic
1107456535 13:40560629-40560651 GGCTGTCCCCAGCACCCTCCTGG + Exonic
1109350771 13:61178383-61178405 GATTGCTTCCAGGACCCTCACGG - Intergenic
1112573319 13:100613597-100613619 GAGTGCTCCCAACACCCTAGAGG + Intronic
1113058449 13:106295660-106295682 GGCTGCTCCCGGCACCATCAAGG + Intergenic
1116021611 14:39468770-39468792 AGGGGATCCCAGCACCCTGAAGG - Intergenic
1116269391 14:42741971-42741993 GGGTGATGCCAGCACTCTCTTGG - Intergenic
1116495286 14:45552855-45552877 AGGTGACCCAAGCACCCTCATGG + Intergenic
1117870141 14:60192050-60192072 GGATGCTCACATCACCCTCCAGG - Intergenic
1119479992 14:74953153-74953175 GGGTGTTCCCAGCACGCAGATGG + Intronic
1120609624 14:86624026-86624048 GGCTGCACCCAGCATCGTCATGG - Intergenic
1121055156 14:90846033-90846055 GGCTCCTTCCTGCACCCTCATGG + Intergenic
1121315897 14:92960834-92960856 TGGTGCTGGCAGCACCCTCCAGG - Intronic
1121750906 14:96355361-96355383 CAGTTCTCCCAGCACCATCAGGG + Intronic
1122357356 14:101131747-101131769 GTGTGCCCCCAGGAACCTCAGGG + Intergenic
1122784438 14:104157341-104157363 GGGTGCTCCCAGGAGGCTCAGGG + Intronic
1122857933 14:104568861-104568883 GGGTGGGCCCTGCACCTTCAGGG + Intronic
1122919962 14:104875981-104876003 GAGGGCTCCCAGCACTCCCACGG + Intronic
1123037513 14:105477489-105477511 GGGTGCTGCCAGCCCCATCAGGG + Intronic
1123119484 14:105910127-105910149 GGGTGGGCCCAGGACCCTCTGGG + Intergenic
1123473167 15:20569516-20569538 AGGTGACCCCAGCACCCTCCAGG + Intergenic
1123644839 15:22430837-22430859 AGGTGACCCCAGCACCCTCCAGG - Intergenic
1123733468 15:23164527-23164549 AGGTGACCCCAGCACCCTCCAGG + Intergenic
1123751598 15:23361902-23361924 AGGTGACCCCAGCACCCTCCAGG + Intronic
1124283971 15:28385827-28385849 AGGTGACCCCAGCACCCTCCAGG + Intronic
1124298726 15:28525787-28525809 AGGTGACCCCAGCACCCTCCAGG - Intronic
1125833477 15:42731792-42731814 CGGTGCCCCCAGCACCACCAGGG + Exonic
1126944000 15:53797759-53797781 GGGTGATGCCAGCACTCTCTTGG - Intergenic
1128972204 15:72117811-72117833 GGGTGGGCCCAGCAGCCTCAGGG + Exonic
1128983428 15:72202382-72202404 GACTGCTCCCAGGACCCCCAAGG + Intronic
1129206949 15:74043039-74043061 GGAAGGCCCCAGCACCCTCAGGG + Exonic
1129609276 15:77039986-77040008 CGCTGCCCTCAGCACCCTCACGG + Intergenic
1129665784 15:77578646-77578668 GGCTACTCCCAGCACCTTCTTGG + Intergenic
1129839613 15:78735569-78735591 AGGTGACCCCAGCACCCTCCAGG + Intergenic
1130259451 15:82344128-82344150 AGGTGACCCCAGCACCCTCCGGG - Intronic
1130269227 15:82435040-82435062 AGGTGACCCCAGCACCCTCCGGG + Intronic
1130281815 15:82525057-82525079 AGGTGACCCCAGCACCCTCCGGG + Intergenic
1130473182 15:84241220-84241242 AGGTGACCCCAGCACCCTCCGGG + Intronic
1130480597 15:84355285-84355307 AGGTGACCCCAGCACCCTCCGGG + Intergenic
1130484792 15:84392721-84392743 AGGTGACCCCAGCACCCTCCAGG + Intergenic
1130491115 15:84432474-84432496 AGGTGACCCCAGCACCCTCCGGG - Intergenic
1130502699 15:84511274-84511296 AGGTGACCCCAGCACCCTCCGGG - Intergenic
1130595467 15:85245810-85245832 AGGTGACCCCAGCACCCTCCGGG + Intergenic
1131174213 15:90200132-90200154 GGGTGGGCACAGCACCCACATGG - Intronic
1131188103 15:90292572-90292594 AGGTGACCCCAGCACCCTCCAGG + Intronic
1131282682 15:91033893-91033915 AGGTGACCCCAGCACCCTCCAGG - Intergenic
1132515362 16:363479-363501 TTGGGCTCCCAGCACCCTGACGG + Intergenic
1132743194 16:1426144-1426166 GGGTGCTCCCAGGTCCCTACAGG - Intergenic
1132755408 16:1482118-1482140 GGGTGCTTCCAGCGCCCTGGGGG - Intergenic
1132997072 16:2828984-2829006 AGGCCCTCACAGCACCCTCAGGG + Intergenic
1133300319 16:4778445-4778467 GGGTGGTTCCAGGACCCCCAGGG - Intronic
1134073303 16:11273745-11273767 GGCAGCTCCCAGCCCCCACAGGG + Intronic
1134814473 16:17194548-17194570 GGGTCCTCCCAGGACCATCCTGG + Intronic
1135757210 16:25108015-25108037 GTGTGCCCCCAGCACAGTCATGG - Intergenic
1136567272 16:31077905-31077927 GGGTGCCCCCAGCCACCTCAAGG + Exonic
1138522207 16:57577579-57577601 GGGTGCTCACATCACCCAGATGG - Intronic
1138658319 16:58503233-58503255 GTGTGAGCCCAGCATCCTCAAGG - Intronic
1139578461 16:67857367-67857389 AGGTGCCCACAGCACCCTAAGGG - Intronic
1141435414 16:83997119-83997141 GGGAGCTCCCAACAGCCCCAGGG + Intronic
1141623136 16:85247730-85247752 GAGTGCTCACAGCAGCCCCAGGG - Intergenic
1142106459 16:88306220-88306242 CTGTGCTGCCAGCACCCTCCAGG + Intergenic
1142124967 16:88405672-88405694 GGGTACTCTGAGCACCCACAGGG - Intergenic
1142132663 16:88438012-88438034 GGTGGCTCCCAGCACCACCAAGG + Exonic
1142200265 16:88757752-88757774 GGGTCCTCCCAACAACCTAAGGG + Intronic
1142362028 16:89631906-89631928 GGGTGGTCCCTGCATCCTCATGG + Intronic
1144170998 17:12659796-12659818 AGTTACTCCCAGCACCCACAAGG - Intergenic
1144739897 17:17576031-17576053 GGGTGATCACAGGACGCTCAGGG + Intronic
1145000583 17:19301936-19301958 GCTTGCTCCTAGCACCCTAAAGG - Intronic
1145272441 17:21411983-21412005 GGGGGCTCCCAGCACCCCTGGGG + Intronic
1145310649 17:21699448-21699470 GGGGGCTCCCAGCACCCCTGGGG + Intronic
1145737262 17:27241566-27241588 GGGTGCTCACCCAACCCTCAGGG - Intergenic
1146289612 17:31598178-31598200 AGGTGCTCCCAGCTTCCTCAGGG - Intergenic
1148050443 17:44767609-44767631 GGGCTCTCCCAGCCCCCTCCTGG + Intronic
1148888817 17:50793090-50793112 GGGCGCTCCCAGCACCCACCTGG + Intergenic
1149005014 17:51796377-51796399 GTGTGCTCCCCTCACCCCCAGGG + Intronic
1149208836 17:54280471-54280493 AGGTGCTTCCAGAACCCACAGGG + Intergenic
1149577800 17:57726548-57726570 GGGTGCTGGCAGCCCCCTTATGG + Intergenic
1151586634 17:75012736-75012758 GGCTGCTCCCACCGCCCGCACGG + Exonic
1151674386 17:75590081-75590103 GGGTTCCCACAGCTCCCTCAGGG - Intergenic
1152004244 17:77668274-77668296 GGGTACTCCCAGCAGCTGCATGG - Intergenic
1152291829 17:79444211-79444233 AGGTTTGCCCAGCACCCTCAGGG + Intronic
1153891810 18:9523867-9523889 TGGTGCTCCCACTTCCCTCATGG + Intronic
1153984477 18:10340466-10340488 GGGAGCTGCCAACACCCCCAGGG + Intergenic
1158453367 18:57586423-57586445 GGTTGCTCGCAGCACCCCCAAGG + Intronic
1158643561 18:59222700-59222722 GTGTGCTGACAGCATCCTCATGG - Intronic
1160411006 18:78675429-78675451 GGATGCTCTCAGCACCATCGGGG - Intergenic
1160596664 18:79980163-79980185 TGGTGCTGCCAGCAGCCTCTTGG - Intronic
1160810943 19:1012688-1012710 GGGTCCTCCCAGCACCCACCTGG - Intronic
1160826143 19:1081445-1081467 GGGCGCTCACAGCCCCCACACGG - Intronic
1161010085 19:1955697-1955719 GAGCACTCCCTGCACCCTCAGGG - Intronic
1161046217 19:2136277-2136299 GGGGGCTCCCAGCACGCCGAGGG - Intronic
1161068169 19:2248326-2248348 GGGTGCACCCACCAGCCCCAGGG + Exonic
1161198839 19:3003019-3003041 GGGGGTGCCCAGCACCATCAGGG + Intronic
1162032543 19:7923696-7923718 GCGGGGTCCCAGCACCCCCAGGG - Intergenic
1162095890 19:8309734-8309756 GGGCGGTCTCAGCACCCTCTTGG + Intronic
1162575192 19:11495192-11495214 GGGGGCTGCCGGCAGCCTCAGGG - Intronic
1163270104 19:16247926-16247948 GGGTCCTCCCTGCAGCCTGATGG + Intergenic
1164384425 19:27760994-27761016 GGGTGATCCCAGCATTCTAATGG - Intergenic
1165063942 19:33218509-33218531 GGCTGCTCCCGGCACCATGAAGG + Intronic
1165827286 19:38712629-38712651 GGGTCCTCCCTCCACCCTCCTGG - Intronic
1166041626 19:40206186-40206208 GGCTGCTCCCAGCAGCCTCTTGG - Intronic
1166888322 19:45974177-45974199 GGGTCCTCCCAGCAGCCTGGGGG - Intergenic
1167642763 19:50690881-50690903 GTATGCTCCCAGGACCCCCATGG + Intronic
1168287054 19:55340303-55340325 GGTCTCTCCCTGCACCCTCAGGG + Intronic
925293668 2:2764234-2764256 GAATGCTTCCAGCACACTCAGGG + Intergenic
927150342 2:20191973-20191995 AGGTGCTCCCTGCAGCCTGACGG - Intergenic
928154886 2:28867799-28867821 CTGTAATCCCAGCACCCTCAAGG + Intronic
929832082 2:45355334-45355356 GGCTGATCCCAACACCCTGAGGG + Intergenic
930177493 2:48315166-48315188 GGGGGCCCCAAGGACCCTCAGGG + Intronic
931773445 2:65519184-65519206 GCCTGCTGCCTGCACCCTCAGGG + Intergenic
932076574 2:68669876-68669898 GGGGGCTCCCACCACCTGCATGG + Intergenic
932743851 2:74314792-74314814 GGCTGGTCCCACCAGCCTCAAGG + Intronic
936284892 2:111174120-111174142 GGGTGCTCAGAGGTCCCTCAAGG + Intergenic
938251131 2:129816736-129816758 GTCTGCTCCCAGCAGCCTCCAGG + Intergenic
938918493 2:135968918-135968940 GTGTAATCCCAGCACCTTCAGGG - Intronic
946118813 2:217490669-217490691 AGGTGCTCCCAGCAGGCTCCGGG + Intronic
946475419 2:220002076-220002098 AGGTCCTCCCAGCAGCCTCCAGG + Intergenic
947534024 2:230929644-230929666 GGGGGCTCCAAGCCCCATCAGGG - Intronic
947899718 2:233711356-233711378 GGGTGCTCTCACCACATTCAGGG - Intronic
948014302 2:234675371-234675393 GGGTGTTCTCAGAACCATCATGG + Intergenic
948698286 2:239745156-239745178 GGTGGCTCCGAGCACCCTCATGG + Intergenic
1168962490 20:1878864-1878886 GGGTGATCCCAGCACCTGCTAGG + Intergenic
1170835289 20:19878673-19878695 GTGTCCACCCAGCATCCTCATGG + Intergenic
1171196170 20:23201190-23201212 GGGAGCTCGGAGCAGCCTCAGGG + Intergenic
1174385994 20:50189111-50189133 GGGTCTTCCCAGCAGCCTCTGGG - Intergenic
1175771516 20:61627463-61627485 GGGTGCTCCTGGCATCCCCAGGG - Intronic
1175810778 20:61856348-61856370 GGGGGCACACAGGACCCTCATGG - Intronic
1175810855 20:61856599-61856621 GGGTACACACAGGACCCTCATGG - Intronic
1175810870 20:61856649-61856671 GGGTGCACACAGGACCCTCGTGG - Intronic
1176034480 20:63029517-63029539 GGGGGGTCCCCGCACCTTCACGG - Intergenic
1176123779 20:63466097-63466119 GCGTGTTCCCAGCATCCTGAGGG - Intronic
1179019205 21:37622993-37623015 GGCTCCTCCCCGCAGCCTCAAGG + Exonic
1179445154 21:41425835-41425857 GGATGATCCCAGCACCAGCAGGG - Intronic
1179507586 21:41852205-41852227 GGATGCCCTCACCACCCTCAAGG - Intronic
1180026907 21:45169917-45169939 GGGTGCTCCCAGGAGCCTCCTGG - Intronic
1180092141 21:45538645-45538667 GGCTGCTCTCAGCCCCCTCAAGG - Intronic
1181311384 22:21946662-21946684 GGGTGGCCCCAGCAGCCTCTGGG - Intronic
1182862958 22:33576682-33576704 GATTGGTTCCAGCACCCTCAAGG + Intronic
1183186343 22:36293604-36293626 GCGTCCTCCCAGCTCCCTCCAGG - Intronic
1184493503 22:44824085-44824107 TGGTGCTCGCAGCACCCACCAGG - Intronic
1185213407 22:49584950-49584972 GGGCTCTCCCTGCACCCTCTGGG - Intronic
1185363462 22:50423231-50423253 GAGTGCTCCCAGGATGCTCACGG - Intronic
1185385864 22:50531109-50531131 GGGTGGTCCCAGCTCCCGGAGGG + Intronic
950808179 3:15626428-15626450 CTGTACTCCCAGCACCCTCAGGG + Intronic
952217797 3:31295129-31295151 TGGAGCCCCCACCACCCTCATGG + Intergenic
954030770 3:47818382-47818404 TGGTTCTCTCAGCACCCGCATGG + Intronic
954320937 3:49831604-49831626 GGGTGCTCCCAATACCTTGAAGG - Intronic
954708103 3:52491809-52491831 TGGTGCTCCCAGCCCCACCAGGG + Intronic
961028989 3:123585526-123585548 GGCTGGTCCCTGCAGCCTCAAGG - Intergenic
961449831 3:126997672-126997694 GGTCGCTCCCTGCATCCTCATGG - Intronic
967511952 3:190322539-190322561 GGGCGCTCCCGGCGCCCTCTCGG - Intronic
968365558 3:198182591-198182613 GGGTGTTACCTACACCCTCAGGG - Intergenic
969523749 4:7693687-7693709 TGGTGCTCCCAGCTCCCAAACGG - Intronic
970716723 4:18935262-18935284 AGGTGCTCCCACCAACCTTATGG + Intergenic
972851533 4:43056927-43056949 TGGTGATGCCAGCACCCTCTTGG - Intergenic
972956219 4:44395489-44395511 GGGTGTTCCCAGAATCCTCATGG - Intronic
976412743 4:84735354-84735376 GGCTGCTCTCAACACCCTCAGGG + Intronic
976635360 4:87281807-87281829 GGGTGTTCCCAGAACTGTCATGG - Intergenic
978595858 4:110376221-110376243 GGGTGATCCCAACTCTCTCATGG - Intronic
982665092 4:158251674-158251696 GGGTGGTCCCAGAACTGTCATGG - Intronic
984870046 4:184317558-184317580 GTGTGCTCACAGCACCCTGGTGG - Intergenic
985658509 5:1144118-1144140 GGACGCACCCACCACCCTCAGGG + Intergenic
986671269 5:10145133-10145155 GAATGCTCCCAAGACCCTCAGGG - Intergenic
988835783 5:35030941-35030963 GGCTGCTGCCAACACCATCACGG - Intronic
997984744 5:138493018-138493040 GGGTGCCCCCATCACCCAGAAGG + Intergenic
1001088868 5:168722246-168722268 GGGTACTCACAGCACTCGCAGGG + Exonic
1001407929 5:171488962-171488984 GGGTGGCCCCAGCTGCCTCAGGG + Intergenic
1001889410 5:175326769-175326791 AGGGGCCCCCAGAACCCTCATGG + Intergenic
1005567940 6:27115237-27115259 GGGAGCTCCCAGAACCCTATAGG + Intergenic
1005865128 6:29931767-29931789 GAGTGCACCCACCTCCCTCAGGG + Intergenic
1005867447 6:29946855-29946877 GAGTGCACCCACCTCCCTCAGGG + Intergenic
1005914319 6:30339627-30339649 GGGAGCTCCCAGCATCCTTGAGG + Intronic
1007848476 6:44780505-44780527 AGGGGCTCCCGGCACCCTCATGG + Intergenic
1011201892 6:84846062-84846084 GACTGCTCCCAGCAGCCACATGG + Intergenic
1016892127 6:149016984-149017006 GGGGGCTCAGAGCATCCTCAAGG + Intronic
1016980240 6:149847058-149847080 GGGTGACGCCAGCAGCCTCATGG - Intronic
1017132534 6:151120090-151120112 GGGTAATCACACCACCCTCATGG - Intergenic
1017560516 6:155623561-155623583 GGGAGCCCCCAGCAGCCACAGGG + Intergenic
1018396616 6:163382746-163382768 TGGTGCTCCCTTCCCCCTCAAGG + Intergenic
1018810297 6:167293894-167293916 TGGGGCACCCAGCACCCTCGTGG + Intronic
1019347347 7:537610-537632 GGGGGCTTCCAGCACCATGAAGG - Intergenic
1019756489 7:2774493-2774515 TGCTGCTCCCTGCACACTCAGGG - Intronic
1023901646 7:44485898-44485920 GAGAGGTCCCAGCACCTTCATGG - Intronic
1025021181 7:55481340-55481362 TTGTGCTCCCAACACTCTCATGG - Intronic
1026967550 7:74450054-74450076 GCGTGCTCCCTGCAGCCTCTGGG - Intergenic
1028441349 7:90865782-90865804 TGGTGCTCTCAACAGCCTCATGG + Intronic
1029946659 7:104540412-104540434 GGGTGCTCCCAGCATCTACTGGG + Intronic
1033564414 7:142564550-142564572 GGGAGCTCCCACCATTCTCATGG - Intergenic
1034219134 7:149431107-149431129 CTGAGCTCCCAGCAACCTCATGG + Intergenic
1035315673 7:157996558-157996580 GGGGGCTCCCACCACCCCGAGGG + Intronic
1036708229 8:11060461-11060483 GGGTGCTCCCTGTACTCCCAGGG + Intronic
1037669008 8:20998234-20998256 TACTGCTCTCAGCACCCTCATGG - Intergenic
1038333164 8:26625470-26625492 GGCAGCTCCCAGCACCCCCCAGG + Intronic
1039180839 8:34864279-34864301 GGGTGTTCCCAGAACTGTCATGG + Intergenic
1040328508 8:46374366-46374388 GGGTGCAGCCAGCACCCACTCGG + Intergenic
1043394886 8:79826651-79826673 GGGAGCACCGAGCAGCCTCAGGG + Intergenic
1047414622 8:124653837-124653859 GGCATCTCCCAGCAGCCTCAAGG - Intronic
1049306858 8:141908532-141908554 GGCTGCACCCAGCACCGTCAGGG + Intergenic
1049434045 8:142578024-142578046 GTGAGCTCCCAGCACCCACAAGG - Intergenic
1049660903 8:143819327-143819349 GGGACCTCCCCACACCCTCAGGG + Intronic
1049749369 8:144276116-144276138 GGCAGGTCCCAGCACCCCCAGGG + Intronic
1049962593 9:750854-750876 GGCTCCTTCCAGCTCCCTCATGG - Intergenic
1050723045 9:8612730-8612752 GGGTGGTCCCACCAGCCTCAGGG - Intronic
1053365347 9:37518782-37518804 GGGTGCTCACTGCCGCCTCAAGG + Intronic
1054980690 9:71202324-71202346 TGGTTCTCCCAGCACGCACATGG - Intronic
1060856145 9:126915572-126915594 GGATGCCCCCAGAATCCTCAGGG - Intronic
1060958925 9:127665184-127665206 GGGGGCAGCCAGCACCATCATGG + Intronic
1061062966 9:128259960-128259982 AGGTGACCCCAGCACCCTCCAGG - Intronic
1061396074 9:130343860-130343882 GACTGAGCCCAGCACCCTCATGG + Intronic
1061870236 9:133516489-133516511 GGGTGCTGCCCCCACCCCCAGGG - Intronic
1062040847 9:134403616-134403638 TGGTGCTCCCAGAATCCTCAGGG + Intronic
1062366917 9:136214590-136214612 GTGGCTTCCCAGCACCCTCATGG - Intronic
1189772626 X:44441641-44441663 AGGGTCTCCCAGCACCATCAAGG - Intergenic
1189772944 X:44444323-44444345 AGGGTCTCCCAGCACCATCAAGG - Intergenic
1191842791 X:65524932-65524954 GGGGGCTCACTGCACCCTTAGGG - Intronic
1192940863 X:75910208-75910230 GGGTGATACCAGCACCCTCTTGG + Intergenic
1193147563 X:78093053-78093075 GGGTGATCCCAGCACTCCCTTGG + Intronic
1193815668 X:86102177-86102199 GGGTGATGCCAGCACTCTCTTGG - Intergenic
1194835170 X:98672720-98672742 GGGTGATGCCAGCACTCTCTTGG + Intergenic
1195967307 X:110440114-110440136 TGTGGCTGCCAGCACCCTCACGG - Intronic
1196368842 X:114952705-114952727 GGGTGATGCAAGCACCCCCATGG - Intergenic
1197134942 X:123050110-123050132 TGGTGCTCACAGCACCCAGAGGG + Intergenic
1202373306 Y:24212566-24212588 AGGTGACCCCAGCACCCTCCAGG - Intergenic
1202497476 Y:25457554-25457576 AGGTGACCCCAGCACCCTCCAGG + Intergenic