ID: 1083173837

View in Genome Browser
Species Human (GRCh38)
Location 11:60937438-60937460
Sequence CCGTGTCCTAGCCCTGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083173829_1083173837 1 Left 1083173829 11:60937414-60937436 CCTCTGTCTTGCGCCCTGTGCCT 0: 1
1: 0
2: 0
3: 30
4: 616
Right 1083173837 11:60937438-60937460 CCGTGTCCTAGCCCTGGGGCTGG 0: 1
1: 0
2: 1
3: 21
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083173837 Original CRISPR CCGTGTCCTAGCCCTGGGGC TGG Intronic
900189934 1:1349101-1349123 CCGCGTCCGAGCCCCGGGCCGGG - Exonic
900556664 1:3284074-3284096 CCATGGCCTGGGCCTGGGGCAGG + Intronic
902336905 1:15759101-15759123 CCGAGTCCCAGCCCGGGAGCGGG + Intronic
902540146 1:17148958-17148980 TCGTGCCCTAGCGCTGTGGCCGG - Intergenic
902618076 1:17634768-17634790 CCCTGGGCCAGCCCTGGGGCAGG + Intronic
902934468 1:19754828-19754850 CTGTGTGCCAGCCCTGGGCCGGG + Intronic
904239509 1:29134745-29134767 CCGTGTCCTGTCCGTGGGGCAGG - Intergenic
904391572 1:30189499-30189521 TCTGGGCCTAGCCCTGGGGCAGG - Intergenic
904698055 1:32341590-32341612 CAGTGTCCAGCCCCTGGGGCAGG - Intergenic
904971999 1:34426535-34426557 CCAGGTCCAAGCCCTGTGGCTGG + Intergenic
905027219 1:34859231-34859253 CCGGGCCCTCGCACTGGGGCAGG - Intronic
905337960 1:37258269-37258291 TGGTCTCCCAGCCCTGGGGCTGG - Intergenic
905580861 1:39081902-39081924 CAGCGGCCGAGCCCTGGGGCCGG - Intronic
905731114 1:40300114-40300136 CGGTGTGCTGGCCCTGGGGTAGG - Intergenic
906654349 1:47536956-47536978 CGGTCTCCTCGCCCTGGGGCGGG - Intergenic
907306803 1:53517807-53517829 CCGGGACCTGGCCCCGGGGCAGG - Intronic
909267276 1:73576929-73576951 CCCTGTCATTGGCCTGGGGCAGG + Intergenic
912517940 1:110227558-110227580 CCGTGTCCTATCCTTGGGCCTGG + Intronic
914195683 1:145446883-145446905 CCGTGTTCTGGGGCTGGGGCTGG - Intergenic
915300863 1:154950916-154950938 CCTTGTGCTGGCCCTGGGCCTGG - Intronic
918045554 1:180938976-180938998 CAGAGCCCTAGCCCTGGGGAGGG + Intronic
919845442 1:201639504-201639526 CTGTGTTCTAGCCTGGGGGCCGG + Intronic
920934449 1:210418192-210418214 GTGTGTCCTGGCCCTGGGGCTGG + Exonic
921160902 1:212471516-212471538 CACTGGCCAAGCCCTGGGGCCGG + Intergenic
1066759494 10:38739007-38739029 CCTTGTCCTTGCCCTGGCACTGG + Intergenic
1066962124 10:42233754-42233776 CCTTGTCCTTGCCCTGGCACTGG - Intergenic
1068213390 10:53952074-53952096 CGGTGTCATAGCCCTGGCTCAGG + Intronic
1070688537 10:78507889-78507911 CTGAACCCTAGCCCTGGGGCAGG + Intergenic
1070794125 10:79207152-79207174 CCCTGCCCTGGCGCTGGGGCAGG + Intronic
1073001123 10:100286761-100286783 CTGTGTCATAGACCTGAGGCTGG - Intergenic
1073192865 10:101664424-101664446 CAGTGTACTGGCCCTAGGGCAGG - Intronic
1076698717 10:132259176-132259198 CAGCCTCCAAGCCCTGGGGCAGG + Intronic
1076729770 10:132432415-132432437 CAGTGTCCCAGCCCTGTTGCCGG - Intergenic
1076994749 11:292460-292482 CCGTGCCCTCGCCCTGGAGGAGG - Intronic
1077413878 11:2415570-2415592 GCGTGACCTGGCCCTGGGGATGG - Intronic
1077609875 11:3637510-3637532 CCGAATCCTCCCCCTGGGGCAGG - Intergenic
1077817014 11:5695787-5695809 CTGTGTGCAAGCCCAGGGGCAGG + Intronic
1079243662 11:18738039-18738061 CCAACTCCTAGCCCAGGGGCTGG + Intronic
1081525334 11:43924329-43924351 CCCAGCCCTGGCCCTGGGGCCGG + Intergenic
1083173837 11:60937438-60937460 CCGTGTCCTAGCCCTGGGGCTGG + Intronic
1083620082 11:64044893-64044915 CTGTGTGCTGGGCCTGGGGCTGG + Intronic
1083826374 11:65206356-65206378 CCTTGTCCTGGCCAAGGGGCTGG - Intronic
1084394030 11:68897139-68897161 CCATATCCCACCCCTGGGGCAGG + Intronic
1084438636 11:69158101-69158123 CCATGTCCCACCCCTGGGGCAGG + Intergenic
1085478161 11:76800779-76800801 CCTTGTCCTACCCCAGGGGCCGG + Intergenic
1090658816 11:128866233-128866255 CCATTCCGTAGCCCTGGGGCTGG - Intronic
1092244589 12:6856479-6856501 CCTTGTCCTTGCTCTGGGGGTGG - Intronic
1096214236 12:49790916-49790938 CCGTGCCCAAGCCCTGGCCCAGG + Intergenic
1101774172 12:107778601-107778623 GCGTGCCCTGGCCCTGGGGCTGG + Intergenic
1102260021 12:111437901-111437923 CTGAGGCCCAGCCCTGGGGCAGG - Intronic
1103012025 12:117465181-117465203 CTGTGTCCCAGCCCTGGGCCTGG - Exonic
1103451623 12:121033326-121033348 CTGTGTCCTATGCTTGGGGCTGG - Intronic
1105414352 13:20195473-20195495 CTGTGTCCTCACCATGGGGCTGG - Intergenic
1113461349 13:110484694-110484716 CAGGGTCCTGGGCCTGGGGCTGG - Intronic
1117176553 14:53152468-53152490 CCCGGTCCCCGCCCTGGGGCCGG + Exonic
1121775095 14:96585084-96585106 CAGCGTCCCAGCCCTGGGCCAGG + Intergenic
1121852825 14:97237700-97237722 CAGGGTCATAGCCCTGGGTCGGG + Intergenic
1122070110 14:99200656-99200678 CTGTGACCCAGCCCTGGAGCTGG - Intronic
1122074685 14:99228541-99228563 CAGTGTCCTGTTCCTGGGGCTGG - Intronic
1122133404 14:99619110-99619132 CCGTGTACTGGCCCTGGTGCTGG + Intergenic
1122278919 14:100609974-100609996 CCCTCCCCCAGCCCTGGGGCAGG - Intergenic
1122626960 14:103089782-103089804 CCTTGTCCTATCCCCGGGCCGGG - Intergenic
1123033913 14:105464102-105464124 CCGGGCCAGAGCCCTGGGGCTGG + Exonic
1123061751 14:105597684-105597706 CCGCGGCCTAGGCGTGGGGCTGG + Intergenic
1123086489 14:105719415-105719437 CCGCGGCCTAGGCGTGGGGCTGG + Intergenic
1126100228 15:45114248-45114270 GGGTGTCCCAGCCCAGGGGCTGG - Intronic
1128192255 15:65713796-65713818 CCTTGCCCTAAACCTGGGGCTGG + Intronic
1129483305 15:75844102-75844124 CCGTCTCCTAGCCCCGAGGGGGG + Intronic
1129957978 15:79656576-79656598 CAGTGTCCCAGCCCTGTGGATGG + Intergenic
1134103932 16:11471798-11471820 CAGTGTCCTACACCTGGGGCTGG - Exonic
1134258448 16:12630766-12630788 CGGTGACCCAGCCCTGGAGCAGG - Intergenic
1136723289 16:32340156-32340178 CCTTGTCCTTGCCCTGGCACTGG - Intergenic
1138205336 16:55120337-55120359 CTGCCTCCTGGCCCTGGGGCAGG - Intergenic
1138505210 16:57475071-57475093 CCGGGCCCTGGCCCTGGGGGTGG - Intronic
1138506427 16:57480492-57480514 CCTTGCCCTGGCCCTGGGGTTGG + Intronic
1139436829 16:66941331-66941353 GAGTGTCATAGCCCTGGGTCGGG + Intronic
1142192238 16:88723336-88723358 CCGGGTCCTAACCCGGGGGCTGG - Intronic
1142417425 16:89949997-89950019 CCGTGCGCCAGGCCTGGGGCTGG + Intronic
1203003143 16_KI270728v1_random:177609-177631 CCTTGTCCTTGCCCTGGCACTGG + Intergenic
1203134748 16_KI270728v1_random:1714015-1714037 CCTTGTCCTTGCCCTGGCACTGG + Intergenic
1142673056 17:1496355-1496377 ACGTGTCCTATGCCTGGGTCGGG - Exonic
1143387235 17:6538309-6538331 CCATGTCCTAACACTGAGGCTGG + Intronic
1144695811 17:17303363-17303385 CCGCGGCCTCGCTCTGGGGCCGG + Exonic
1144833400 17:18144061-18144083 CATTGTCCTTGCCCTGGGGCAGG + Intronic
1145794694 17:27648984-27649006 CGGCTTCCTGGCCCTGGGGCCGG + Exonic
1148558108 17:48590649-48590671 CTGGGCCCTAGCCCTGGGCCAGG + Intronic
1149589339 17:57817045-57817067 CCTAGTCCTAGCCCTGGAGTTGG + Intergenic
1150667186 17:67152138-67152160 CCCCTTCCTAGCCCTGGAGCCGG - Intronic
1151535906 17:74738629-74738651 CTGGGTCCCAGCCCTGGAGCAGG - Intronic
1151666788 17:75549760-75549782 TCAGGTCCTAGCCCTTGGGCAGG + Intronic
1152242568 17:79168013-79168035 CCCTCACCCAGCCCTGGGGCTGG - Intronic
1152471842 17:80493835-80493857 GCGTGAGCTAGCCCTGGGCCAGG + Intergenic
1152544484 17:80993854-80993876 CCCTGTCCTGGCCGTGTGGCTGG + Intronic
1152559926 17:81072839-81072861 CCCAGTCCTTGCTCTGGGGCCGG + Intronic
1152562903 17:81087445-81087467 CTGTGGCCTCGCCCTGGGACTGG + Intronic
1152838154 17:82548759-82548781 CCGTGACCTCACCCTGGGGGAGG + Intronic
1157498293 18:48171740-48171762 CCGGGTCCTAGCTCCTGGGCTGG + Intronic
1160677458 19:399014-399036 CAGTGTCCTGGCTCTGGGGTTGG + Intergenic
1162144546 19:8605662-8605684 CTGGGCCCTCGCCCTGGGGCTGG - Exonic
1163441180 19:17323523-17323545 CCGTGTGCTGGCCCAGCGGCTGG - Exonic
1163525466 19:17818269-17818291 CCTAGTCCTGGCCCTGGTGCAGG - Intronic
1164524360 19:29002514-29002536 CCCTGAGCTAGCCCTGGGGAGGG + Intergenic
1166784467 19:45359371-45359393 CTGGGCCCTTGCCCTGGGGCTGG - Intronic
925401252 2:3575047-3575069 CCTCGTCCCAGCCCTGGGCCTGG - Intergenic
926207740 2:10846004-10846026 CCTTGTCCCAGCCCTGGGGGAGG + Intergenic
927518113 2:23683595-23683617 CGGTGTCTTGGACCTGGGGCTGG - Intronic
927866006 2:26588119-26588141 CGGTCTCCAGGCCCTGGGGCTGG - Intronic
927946348 2:27137405-27137427 CCCTGGCCTGGCCCTGAGGCAGG + Exonic
928162085 2:28937728-28937750 CTGTGTCATAGACCTTGGGCAGG - Intronic
931778747 2:65562171-65562193 CTGTGGCCCAGCCCTGGTGCTGG - Intergenic
932417780 2:71584141-71584163 CCTGGGCCTGGCCCTGGGGCTGG + Intronic
934322813 2:91983358-91983380 CCTTGTCCTTGCCCTGGCACTGG + Intergenic
934557723 2:95296341-95296363 CTGTGTCCTGTCCCTTGGGCGGG - Intergenic
934766535 2:96883088-96883110 CCGTGCCCTCCCCCTGGGGAAGG + Intronic
942503105 2:176612862-176612884 CCGTGTGCCAGCACTGGGCCAGG + Intergenic
946338809 2:219055740-219055762 CCGTGTGCTGGCCATGGGGGAGG - Exonic
947872939 2:233449797-233449819 CCTGGTCCTGGCACTGGGGCAGG - Intronic
948281671 2:236751870-236751892 TGGTGTCTTTGCCCTGGGGCAGG + Intergenic
1168837612 20:888222-888244 CCCAGTCCTAGCCCTGGCTCTGG + Intronic
1169925971 20:10784202-10784224 CAGTGTCCAAGCCCTGCCGCTGG + Intergenic
1172689505 20:36780554-36780576 CAGTGCCCTGGCCCTGGGGTGGG - Exonic
1173254056 20:41380915-41380937 CCGTCTCCCAGCCTCGGGGCAGG + Intergenic
1173663671 20:44750901-44750923 CCGTTTCCAATCCCTGGGGAGGG - Exonic
1174352555 20:49979180-49979202 CCGCGCCCCAGGCCTGGGGCGGG + Intergenic
1174368915 20:50073268-50073290 CCTAGGCCTGGCCCTGGGGCTGG - Intergenic
1174414841 20:50359866-50359888 CCCTGGCCAAGCCCTGGGCCAGG - Intergenic
1175056370 20:56202387-56202409 CCCTGATCTAGCCCAGGGGCTGG - Intergenic
1175128003 20:56766842-56766864 CCATGTGCCAGCCCTGGAGCAGG + Intergenic
1175345139 20:58267725-58267747 CCGTGACCTAGCACAGGGTCTGG - Intergenic
1175723885 20:61303767-61303789 CCGTGTCCCGGGCCTGGGGGTGG - Intronic
1175862504 20:62157810-62157832 GCATGACCTAGACCTGGGGCTGG - Intronic
1176264189 20:64200142-64200164 CCGTGTCCTTGCCATGATGCTGG - Intronic
1179623259 21:42632621-42632643 CCATGAACTAGGCCTGGGGCAGG - Intergenic
1179710407 21:43209997-43210019 CCGGGTGCTGGCCCAGGGGCAGG - Intergenic
1179957296 21:44748808-44748830 CCAGGTGATAGCCCTGGGGCTGG - Intergenic
1180093102 21:45542579-45542601 CCGTCTCCCAGCCCCGGCGCCGG + Intronic
1180549573 22:16529256-16529278 CCTTGTCCTTGCCCTGGCACTGG + Intergenic
1181493515 22:23275251-23275273 GCTTGTCCAAGCCCTGGAGCTGG + Intronic
1181862350 22:25828845-25828867 CCCGGTCCTTGCCCTGGTGCCGG - Exonic
1183314528 22:37129559-37129581 CCGGGTTCTAGCCCTGGCCCTGG + Intronic
1183788946 22:40049281-40049303 CCGTGTCCTAGCACTTTGGGAGG - Intronic
1184243219 22:43222432-43222454 CCGAGTTCTAGCCCAGGGTCAGG - Intronic
1184500056 22:44865953-44865975 CCCTGTCCTCCCCCTGGGCCGGG - Intergenic
1184599624 22:45535383-45535405 CAGCGACCTAGCCTTGGGGCAGG + Intronic
1184690723 22:46116109-46116131 CCTTGTCCTAGCCCTGGCCCTGG - Intergenic
1184697196 22:46146655-46146677 CCATGATCTAGCCCTGGAGCTGG + Intergenic
1185297571 22:50061919-50061941 CCTTGCCCTGGCTCTGGGGCGGG + Intronic
1185322862 22:50209836-50209858 CAGTGGCCTGGCCCTGGGGCAGG + Intronic
949949969 3:9221036-9221058 GCATGTCCTGGCCATGGGGCTGG - Intronic
950480028 3:13238359-13238381 AAGTGTGCTGGCCCTGGGGCTGG - Intergenic
955424873 3:58777803-58777825 CCTTGTCTTAGCCTTGAGGCCGG - Intronic
956822023 3:72962623-72962645 CTGGGACCTAGCCCTGTGGCTGG - Intronic
961474256 3:127136868-127136890 CCATCTCCTAGCCCAGGGCCAGG - Intergenic
961553498 3:127681993-127682015 TCGTGTCATGGCCCTGGGGGAGG + Intergenic
961647133 3:128398599-128398621 CCGTGTCCGGGCCCTGGGGCAGG + Intronic
961780823 3:129319200-129319222 CCGTGTCCTCCCCCCGGGACTGG - Intergenic
964569148 3:158094236-158094258 CAGTGTCCAAACTCTGGGGCAGG - Intergenic
966086861 3:176078863-176078885 CCATATCCTAGGCCTGGGGATGG - Intergenic
967948419 3:194822365-194822387 CCGTGTCCTGGCCCTGCTGCTGG - Intergenic
968195767 3:196704950-196704972 AAGTGTATTAGCCCTGGGGCTGG - Intronic
968503365 4:961189-961211 CCTGGACCTGGCCCTGGGGCGGG + Exonic
968503387 4:961251-961273 CGCTGACCTGGCCCTGGGGCGGG + Intronic
968503409 4:961308-961330 CCTGGACCTGGCCCTGGGGCGGG + Intronic
968503435 4:961370-961392 CCTGGACCTGGCCCTGGGGCGGG + Intronic
968701313 4:2059434-2059456 CCGCGCCCTTGCCCTGGGCCCGG + Intergenic
968902103 4:3436663-3436685 CTCTGGCCTAGGCCTGGGGCAGG - Intronic
969046704 4:4341626-4341648 CCATGCCCAAGACCTGGGGCAGG - Intergenic
969410616 4:7025644-7025666 CCGTGGCCATGCCCTGTGGCAGG + Intronic
969525776 4:7703378-7703400 GCGTCTGCTAGCCCCGGGGCAGG + Intronic
970695974 4:18677620-18677642 TAGTGTCCTTGCCCTGTGGCTGG + Intergenic
972375863 4:38469617-38469639 CCCTGTCCTAGGGCTGGGGCTGG - Intergenic
985103525 4:186480534-186480556 TTGTGTCCTACACCTGGGGCGGG + Intronic
985481360 5:112995-113017 CCGTGGCCCTGTCCTGGGGCAGG - Intergenic
985489539 5:171327-171349 CTGTGGCCTGGCCCAGGGGCAGG + Exonic
990821128 5:59841545-59841567 CCAGGTCCTAGCCCTGTGACTGG - Intronic
992002745 5:72451746-72451768 TCATTTCCTAGACCTGGGGCAGG - Intronic
997588909 5:135061134-135061156 ACCTGTCCCAGCCCTGGGGCAGG + Intronic
998903227 5:146877881-146877903 CCGGGCCCTAGGGCTGGGGCGGG - Intronic
1002559864 5:180073733-180073755 CGGGGTCCTCGCCCTGGGCCTGG + Intergenic
1005682064 6:28217620-28217642 CCGTCTACCTGCCCTGGGGCCGG - Intergenic
1007110417 6:39310416-39310438 CCGTTTCTCAGCCCTGGGGGAGG - Intronic
1007609739 6:43141824-43141846 CCGTGGCAGGGCCCTGGGGCTGG + Intronic
1007699728 6:43759574-43759596 TCGTGGCCTGGCCCTGGGGCAGG - Intergenic
1011112657 6:83854863-83854885 CCGTGTGCTAGCACTGGTGAAGG + Intronic
1011497452 6:87950506-87950528 CAGTGCCATTGCCCTGGGGCAGG + Intergenic
1013748033 6:113368610-113368632 GCGTGCCCTAGCACTGTGGCTGG - Intergenic
1016834277 6:148461668-148461690 CCAAGTCCTGGCCCTGTGGCTGG + Intronic
1018395560 6:163375588-163375610 CCGTGAGCTGGCCCTGGAGCTGG + Intergenic
1019842309 7:3459773-3459795 CCATGTCCTTGGCCTGGGGTAGG + Intronic
1022296142 7:29055627-29055649 ACATGTCCCAGCCCTGGTGCTGG + Intronic
1023074701 7:36471271-36471293 CCCTGTCCTAGCCCTGGTTTAGG - Intergenic
1025990090 7:66491141-66491163 CCGTTTCCTGGCCCTGGAGGCGG - Intergenic
1026870046 7:73845263-73845285 GCCTGTTCTAGCCTTGGGGCTGG + Intergenic
1032097258 7:128945835-128945857 CCTTGGCCCAGGCCTGGGGCAGG - Exonic
1032513953 7:132493284-132493306 CCATGCCCTAGGCCTGGGGCTGG + Intronic
1034978529 7:155461445-155461467 CCCTGTCCAAAACCTGGGGCAGG + Intronic
1035534629 8:381718-381740 CCGTGGCCAGGCACTGGGGCTGG + Intergenic
1035761163 8:2070007-2070029 GCAGGTCCTAGGCCTGGGGCGGG - Intronic
1036770668 8:11576390-11576412 CCGGTTCCTAACACTGGGGCCGG - Intergenic
1037432371 8:18827322-18827344 CTGTGACCTATCCCTGGTGCTGG - Intronic
1048488771 8:134872283-134872305 CTGTTTCCTAGCCCTTGGGTTGG + Intergenic
1049251871 8:141593507-141593529 CCCTGTCCTAGGCATGTGGCAGG + Intergenic
1049709488 8:144057221-144057243 CCGTGTCCATGCCCAGGGCCCGG + Exonic
1055394705 9:75861744-75861766 CCCTGAGGTAGCCCTGGGGCTGG + Intergenic
1055513250 9:77015312-77015334 ACGTTTCCGAGTCCTGGGGCTGG + Intergenic
1056835177 9:89949151-89949173 CCATTCCCTAGGCCTGGGGCAGG + Intergenic
1057857048 9:98609841-98609863 CAGTGTCCTGGCCCTGAGCCTGG - Intronic
1059385089 9:113958383-113958405 CCGTGTGCCAGCCCTGGCTCAGG - Intronic
1060857041 9:126922795-126922817 CCTTGTACCAGCCCTGGGGTAGG - Intronic
1060928613 9:127473632-127473654 ACCGGTCCTAGCCCTGGGCCTGG - Intronic
1060945434 9:127567469-127567491 CCTTGTGCCAGGCCTGGGGCTGG - Intronic
1061627853 9:131852034-131852056 CCATGACCTGGGCCTGGGGCCGG + Intergenic
1061828172 9:133274775-133274797 CCTTGTCCTAGTCCAGGGTCGGG + Intronic
1061838912 9:133346623-133346645 GCGTCTCCTTGCTCTGGGGCAGG + Exonic
1061866651 9:133494815-133494837 TCGTGTCCCAGCCATGGGGGCGG - Intergenic
1062274049 9:135722281-135722303 CCCCGTCCCACCCCTGGGGCCGG + Intronic
1062592869 9:137281825-137281847 CCTTCCCCTAGCCCTGGGGTTGG - Exonic
1062698983 9:137889467-137889489 CCGTGTTCTGGGGCTGGGGCTGG + Intronic
1187042996 X:15616748-15616770 CCATGTCCTTGCCCTTGGTCAGG - Intergenic
1190476000 X:50827953-50827975 ACGTTTCCTAGGCCTGGAGCTGG - Intergenic
1192219852 X:69190253-69190275 CCGTGTTCTGACCCAGGGGCCGG + Intergenic
1194333534 X:92615497-92615519 CCCTGTTGAAGCCCTGGGGCAGG - Intronic
1200107444 X:153723087-153723109 CTGTGCCCTAGCCCTGGGACTGG - Intronic
1200642216 Y:5734501-5734523 CCCTGTTGAAGCCCTGGGGCAGG - Intronic
1202583314 Y:26403381-26403403 CCTTGTCCTTGCCCTGGCACTGG - Intergenic