ID: 1083175989

View in Genome Browser
Species Human (GRCh38)
Location 11:60950939-60950961
Sequence CGGCGGGTGTGGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 713
Summary {0: 1, 1: 0, 2: 2, 3: 66, 4: 644}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083175989_1083176003 13 Left 1083175989 11:60950939-60950961 CCTCCTTCCCTCCACACCCGCCG 0: 1
1: 0
2: 2
3: 66
4: 644
Right 1083176003 11:60950975-60950997 CAGGCCTCCTGCCACTCACCTGG 0: 1
1: 0
2: 8
3: 47
4: 333
1083175989_1083175997 -10 Left 1083175989 11:60950939-60950961 CCTCCTTCCCTCCACACCCGCCG 0: 1
1: 0
2: 2
3: 66
4: 644
Right 1083175997 11:60950952-60950974 ACACCCGCCGGAGTATGCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 12
1083175989_1083176005 17 Left 1083175989 11:60950939-60950961 CCTCCTTCCCTCCACACCCGCCG 0: 1
1: 0
2: 2
3: 66
4: 644
Right 1083176005 11:60950979-60951001 CCTCCTGCCACTCACCTGGTCGG 0: 1
1: 0
2: 0
3: 28
4: 247
1083175989_1083176008 26 Left 1083175989 11:60950939-60950961 CCTCCTTCCCTCCACACCCGCCG 0: 1
1: 0
2: 2
3: 66
4: 644
Right 1083176008 11:60950988-60951010 ACTCACCTGGTCGGCACCGAAGG 0: 1
1: 0
2: 1
3: 3
4: 36
1083175989_1083176000 -6 Left 1083175989 11:60950939-60950961 CCTCCTTCCCTCCACACCCGCCG 0: 1
1: 0
2: 2
3: 66
4: 644
Right 1083176000 11:60950956-60950978 CCGCCGGAGTATGCCGGGGCAGG 0: 1
1: 0
2: 0
3: 3
4: 57
1083175989_1083176009 29 Left 1083175989 11:60950939-60950961 CCTCCTTCCCTCCACACCCGCCG 0: 1
1: 0
2: 2
3: 66
4: 644
Right 1083176009 11:60950991-60951013 CACCTGGTCGGCACCGAAGGAGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083175989 Original CRISPR CGGCGGGTGTGGAGGGAAGG AGG (reversed) Intronic
900034227 1:393538-393560 CGGCTGTTCTGCAGGGAAGGAGG - Intergenic
900055062 1:623428-623450 CGGCTGTTCTGCAGGGAAGGAGG - Intergenic
900269219 1:1778573-1778595 CGGCGGGCGTGGCGGGAAAGAGG + Intronic
900312507 1:2040972-2040994 AGCTGGGTGTGGAGGGAAAGGGG - Intergenic
900319224 1:2074306-2074328 CGGTGGCTGTGGAGGGCTGGGGG + Intronic
900698030 1:4024400-4024422 TGGCTGGTGGGGAGGGCAGGGGG + Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900888314 1:5430938-5430960 CGGCAGGTGTGGGGGGATGGTGG - Intergenic
901453811 1:9352076-9352098 GTGAGGGGGTGGAGGGAAGGTGG + Intronic
901540262 1:9910629-9910651 CCGGGGGTGAGCAGGGAAGGCGG + Intergenic
901691498 1:10976257-10976279 CTGCGGGAGAGGAGGGAAGGGGG + Intronic
902363735 1:15957361-15957383 CGGTGTGTGTGGAGAGGAGGAGG + Intronic
902363745 1:15957400-15957422 CGGTGTGTGTGGAGAGGAGGAGG + Intronic
902396083 1:16133066-16133088 GTGCAGGTGTGGGGGGAAGGTGG + Intronic
902577897 1:17389856-17389878 CGGCCGGTGTGGAGCGAGTGGGG - Intronic
903233860 1:21937329-21937351 GGGCGGGCGGGGAGGAAAGGGGG - Intergenic
903251089 1:22053255-22053277 CGGCGGGGGTGGGGGGGCGGGGG + Intronic
903295876 1:22342866-22342888 GGTCAGGTGTGGAGGGAGGGGGG - Intergenic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
904289886 1:29478305-29478327 CGGCTGGAGTACAGGGAAGGGGG - Intergenic
904322609 1:29707307-29707329 AGGGGAGTGGGGAGGGAAGGAGG + Intergenic
904605650 1:31696317-31696339 GGGTGGGTGGGGGGGGAAGGAGG - Intronic
904720067 1:32500838-32500860 CGGCGGCGGCGGCGGGAAGGCGG + Intronic
905166543 1:36086471-36086493 CTGCGGGTGTGTAGGGCACGTGG + Intronic
906262733 1:44406219-44406241 TGAAGGGTGTGGAGGGAGGGAGG + Intronic
906274525 1:44506265-44506287 TGGCGGGTGTGGAGGGGTGAAGG + Intronic
906326594 1:44850041-44850063 CAGGGGTGGTGGAGGGAAGGTGG + Intergenic
906398914 1:45490735-45490757 CGTCGGGTGCGGAGGGACGCAGG + Intronic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
907755200 1:57304313-57304335 GGGAGGGTGTGGGGGGGAGGTGG - Intronic
908250104 1:62258978-62259000 TGGCTGGAGTGGAGGGAAGGAGG + Intronic
908329020 1:63052196-63052218 CTGCGAGTGTGGTGGCAAGGAGG - Intergenic
910176727 1:84438682-84438704 CGGTGGGTGGTGGGGGAAGGTGG + Intergenic
910477648 1:87624019-87624041 CGGGGGGTGGGGAGGGGGGGCGG - Intergenic
912233037 1:107817673-107817695 AGGGGGGTGAGGAGGCAAGGAGG + Intronic
912497264 1:110099691-110099713 CGGCAGGGAGGGAGGGAAGGAGG + Intergenic
913013966 1:114713979-114714001 CTGGGGGTGTGGAGGGTAAGGGG + Intronic
914703815 1:150155599-150155621 CGGGGTGTCTGGAGGGAACGAGG - Intronic
915103149 1:153515128-153515150 AGGTGGGTGCAGAGGGAAGGAGG - Intergenic
915213199 1:154324984-154325006 TGGTGGGGGCGGAGGGAAGGAGG + Exonic
915738982 1:158103808-158103830 AGGCGGGTGGGGTGGGAGGGCGG - Intergenic
916178104 1:162059766-162059788 CTGCTTTTGTGGAGGGAAGGTGG - Intergenic
917273623 1:173305862-173305884 CCGCACATGTGGAGGGAAGGAGG - Intergenic
917509687 1:175659824-175659846 TGGCAGGTGTGGTGGGGAGGAGG + Intronic
917975869 1:180237211-180237233 CGGCGGGGGGGGCGGGGAGGAGG + Intronic
918093277 1:181315371-181315393 CAGCGCGGGTGGAGGGATGGAGG + Intergenic
919299465 1:195742025-195742047 GGGCGGGGGTGGGGGGAGGGGGG + Intergenic
919299480 1:195742046-195742068 GGGCGGGGGTGGGGGGAGGGGGG + Intergenic
919814292 1:201428048-201428070 TGGCGGGTGTGGGGGGGGGGGGG - Intronic
920339628 1:205267793-205267815 CGCCTGGTGGGGAGTGAAGGGGG + Intronic
920428299 1:205896678-205896700 GGGAGGGAGGGGAGGGAAGGAGG - Intergenic
920837425 1:209524572-209524594 CTGGGAGAGTGGAGGGAAGGGGG + Intergenic
922256583 1:223897707-223897729 CGGCTGTTCTGCAGGGAAGGAGG - Intergenic
922741291 1:228015701-228015723 CGGCGGGGGTGGGGGGGAGGCGG - Intronic
922758550 1:228109812-228109834 GGGCGGGGGCTGAGGGAAGGAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924048322 1:240054908-240054930 GGGAGGGGGTGCAGGGAAGGAGG + Intronic
924415044 1:243849983-243850005 CGGAGGGAGTGGAGGCCAGGCGG + Intronic
1062857215 10:785316-785338 CGGCGGGTGCTGCGGGCAGGGGG - Intergenic
1062967927 10:1624456-1624478 CAGCCGGTGGGGAGGCAAGGTGG - Intronic
1063151212 10:3338039-3338061 CGGCGGGTGGGGGTGGAGGGTGG + Intergenic
1063724481 10:8621832-8621854 CTGGGGGTGTGGTGGGAGGGTGG - Intergenic
1065422992 10:25567829-25567851 CGTAGGGTGTGGATTGAAGGTGG + Intronic
1066731263 10:38439068-38439090 ATGAGAGTGTGGAGGGAAGGGGG + Intergenic
1066999602 10:42595698-42595720 GGTCGGGTGTGGTGGGCAGGGGG - Intronic
1067781655 10:49211968-49211990 TGGAGGGAGTGGAGGAAAGGAGG + Intergenic
1068051862 10:51960494-51960516 TGGGGGGTGTGGTGGGGAGGGGG - Intronic
1069035967 10:63646214-63646236 CGGCGGGTGGGGAGGGCAGGGGG + Intergenic
1069452362 10:68527617-68527639 CGCCGGGTGAGGCGGGATGGAGG - Intergenic
1069771855 10:70905451-70905473 TGCCGGGAGTGGAGGGGAGGTGG - Intergenic
1070856697 10:79612385-79612407 TGGAGAGTGTGGAGAGAAGGGGG + Exonic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1071847502 10:89535635-89535657 GGGCGGGTGTGGCAGGAGGGCGG - Intronic
1071973434 10:90931140-90931162 AGGCGGATGAGGAGGGAATGTGG - Intergenic
1072409197 10:95184390-95184412 CGGCGGGGGTGGGGGGATGGCGG + Intergenic
1073075560 10:100824071-100824093 TGGCAGGTGTGGAGAGCAGGGGG - Intronic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073645319 10:105295717-105295739 TGTTGGGGGTGGAGGGAAGGGGG - Intergenic
1073730847 10:106285796-106285818 CAGCGGGTGTCAGGGGAAGGTGG + Intergenic
1074439069 10:113459148-113459170 GGGAGGGCATGGAGGGAAGGAGG - Intergenic
1075258066 10:120940731-120940753 AGGTGGGTGTGGCGGGAGGGAGG - Intergenic
1075627382 10:123972671-123972693 GGGCGGGGATGGAGGGACGGAGG + Intergenic
1075701020 10:124469481-124469503 GGGCTGGTGTGAAGGGAAGGTGG - Intronic
1076120583 10:127934002-127934024 CGCGGGGGGTGGGGGGAAGGGGG - Intronic
1076764949 10:132627905-132627927 CGTCGGGTGTGGAGAGAAACTGG + Intronic
1076993965 11:289419-289441 GGGCGTGTGTGGAGGGTGGGGGG - Intronic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1077214959 11:1391346-1391368 GGGCAGGGGTGGAGGGAAGGAGG + Intronic
1077292424 11:1804121-1804143 CGGCAGGTGTGGAGGGCGGCGGG + Intergenic
1077292430 11:1804137-1804159 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292435 11:1804153-1804175 CGGCGGGTGTGGACGGGCGGCGG + Intergenic
1077292441 11:1804170-1804192 CGGCGGGTGTGGACGGGCGGCGG + Intergenic
1077292448 11:1804187-1804209 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292454 11:1804203-1804225 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292459 11:1804219-1804241 CGGCGGGTGTGGACGGGCGGCGG + Intergenic
1077292465 11:1804236-1804258 CGGCGGGTGTGGACGGGCGGCGG + Intergenic
1077292472 11:1804253-1804275 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292478 11:1804269-1804291 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077292484 11:1804285-1804307 CGGCGGGTGTGGAGGGCGGCGGG + Intergenic
1077859268 11:6160501-6160523 GGGCGGGGGTGGGGGGTAGGGGG + Intergenic
1077914690 11:6603696-6603718 CGGTGGGAGGGGAGGGACGGAGG + Intronic
1077923073 11:6655824-6655846 CGGGGGGAGGGGAGGGGAGGGGG - Exonic
1078340850 11:10497138-10497160 CAGTGGGTGTGGGGGGATGGGGG + Intronic
1079085668 11:17443117-17443139 CTGCTGCTGTCGAGGGAAGGAGG + Intronic
1079329581 11:19522498-19522520 CGGCTGGTGAGGAGGGAAGAAGG - Intronic
1079362457 11:19780354-19780376 ACTAGGGTGTGGAGGGAAGGTGG - Intronic
1079512584 11:21228717-21228739 GGGAGGGAGGGGAGGGAAGGAGG - Intronic
1080383401 11:31796591-31796613 CGGTGGGGGTGGAAGCAAGGGGG + Intronic
1080432123 11:32208966-32208988 AGGAGGGAGGGGAGGGAAGGGGG + Intergenic
1080666046 11:34337257-34337279 CAGGGGCTGTGTAGGGAAGGAGG + Intronic
1081574400 11:44310193-44310215 AGGCCGGCGTGGAGGGGAGGAGG - Intergenic
1081773469 11:45663560-45663582 AGCCGGGTGTTGAGTGAAGGGGG + Intronic
1081991782 11:47341970-47341992 CGGTGAGTGTGCAGGGCAGGTGG - Exonic
1082816881 11:57514984-57515006 CGGCGGGAGGAGAGGGAACGCGG + Intronic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083474316 11:62906162-62906184 CGGTGGGAGTGGAAGGAAGGTGG + Intergenic
1083902707 11:65651335-65651357 AGGCTGGTGAGGAGGGAAGTGGG - Intergenic
1085034719 11:73292966-73292988 CGGGGGGTGGGGGGGGGAGGTGG + Intronic
1085095959 11:73760854-73760876 CCGCGGCTGGGAAGGGAAGGAGG + Exonic
1085256235 11:75175127-75175149 TGGGGAGTGGGGAGGGAAGGGGG + Intronic
1085300127 11:75453012-75453034 CGGTGGGTGGGGCAGGAAGGGGG + Intronic
1086755709 11:90558837-90558859 GGTGGGGTGTGGAGGGAAAGGGG + Intergenic
1086940774 11:92795995-92796017 TGCCGGGTGTGGAGTGAGGGAGG + Intronic
1087091852 11:94281703-94281725 CTGGGGGTGAGGAGGGGAGGTGG + Intergenic
1088952640 11:114586948-114586970 GGGGGTGTGGGGAGGGAAGGAGG - Intronic
1089078560 11:115758688-115758710 CGAGGGGAGTGGAGGCAAGGAGG + Intergenic
1089744941 11:120610053-120610075 AGGCAGATGGGGAGGGAAGGAGG - Intronic
1089915625 11:122153003-122153025 CGGGGGGTGCGGGGGGAAGGAGG - Intergenic
1090305057 11:125684138-125684160 CGGCAGGTGGGGCGGGGAGGTGG + Intergenic
1090313429 11:125763885-125763907 CTGAGGGTGTGGAAGGCAGGAGG - Intergenic
1090366620 11:126211829-126211851 CGGTGAGTGTGTAGGGAAGCCGG + Exonic
1090580398 11:128152869-128152891 AGGAGGGAGGGGAGGGAAGGAGG + Intergenic
1090580415 11:128152913-128152935 AGGAGGGAGGGGAGGGAAGGAGG + Intergenic
1091159734 11:133409090-133409112 CGTGGGCTGTGGAAGGAAGGAGG + Intronic
1091268290 11:134287803-134287825 CAGAGGGTGAGGCGGGAAGGAGG + Intronic
1091402494 12:189386-189408 CGGCTAGTGGGGAGAGAAGGAGG - Intergenic
1091404267 12:199141-199163 GGGAGGGTGGGGAGGGGAGGAGG + Intronic
1091446009 12:544458-544480 AGGCAGGTGTGGAGGGAGGTGGG - Intronic
1091518800 12:1214512-1214534 GGCGGGGAGTGGAGGGAAGGAGG - Intronic
1092004452 12:5057366-5057388 AGATGGGTGTGGAGGGATGGAGG + Intergenic
1093053501 12:14532088-14532110 CCGTGGGTGAGGAGTGAAGGTGG - Intronic
1093518934 12:20025160-20025182 AGGGGGGTGTGAAGGGGAGGAGG + Intergenic
1093926297 12:24911693-24911715 CGAGGGGTGGGGAGGGAAGAGGG - Intronic
1094580366 12:31728864-31728886 CGGCGGGGGGGGTGGGAAAGGGG + Intronic
1095440945 12:42238264-42238286 GGGCGGGGGAGGAGGGAGGGAGG + Intronic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1095811770 12:46379615-46379637 CTGAGGGAGTGGAGGGGAGGAGG - Intergenic
1096681047 12:53255480-53255502 AGAAGGGTGGGGAGGGAAGGAGG + Intergenic
1096773875 12:53952507-53952529 CTGCTGGGGTGGAGGGAATGGGG + Intergenic
1096799041 12:54097239-54097261 CCACAGGTGTAGAGGGAAGGAGG - Intergenic
1097029477 12:56080767-56080789 CGGCGCGGGTGGGGGGCAGGGGG - Intronic
1097107703 12:56635040-56635062 CGGCGGCGGCGGAGGGGAGGAGG + Intronic
1097265883 12:57744713-57744735 CGGCGGGAGGGGCGGGTAGGGGG - Intronic
1097338832 12:58414748-58414770 GGGGGGGTGGGGAGGGAAGGAGG + Intergenic
1097889941 12:64767785-64767807 CGGCGGGGGGGGGGGGAGGGGGG + Intergenic
1098038688 12:66333232-66333254 CAGGGGGTGTGGTGGGCAGGAGG + Intronic
1098300884 12:69053160-69053182 TGGGAGGTGTGGAGGGCAGGGGG + Intergenic
1098416836 12:70243687-70243709 TGGCGGCGGTGGAGGGAGGGAGG + Intronic
1100726736 12:97416880-97416902 TGGGGGGTGTGGGGGGAGGGGGG + Intergenic
1101045537 12:100801749-100801771 GGGGTGGGGTGGAGGGAAGGTGG + Intronic
1101339012 12:103824765-103824787 GGGCAGGGGTGGAGGGAGGGTGG - Intronic
1101488712 12:105192453-105192475 GGGCGGGTGGGGAGGGAGGCAGG - Intronic
1102188098 12:110965390-110965412 GGGGGGGTGTGGAGGGGAGTGGG - Intergenic
1102239133 12:111312935-111312957 TGGTGGGGGTGGAGGGAAGCGGG - Intronic
1102550108 12:113685426-113685448 GGGGGGCTGGGGAGGGAAGGGGG + Intergenic
1102561044 12:113762530-113762552 CTGGGGGTGGGGAGGGAGGGGGG - Intergenic
1102566794 12:113802360-113802382 TGGGGGAGGTGGAGGGAAGGAGG + Intergenic
1102678763 12:114676065-114676087 TGGCTGGTGGGGAGGGGAGGTGG - Intronic
1102766450 12:115437572-115437594 GGGAGGGTGTGGATGGCAGGCGG + Intergenic
1103705080 12:122867134-122867156 CGGCTGGTGTGGAGGGAGCCGGG + Exonic
1103879806 12:124157389-124157411 AGGTGGGAGTGGAGGGAACGAGG + Intronic
1104636632 12:130441770-130441792 CTGCTAGTGGGGAGGGAAGGTGG - Intronic
1104916637 12:132268921-132268943 TGGCGGGTGGGGACGGGAGGTGG + Intronic
1104920132 12:132286211-132286233 CGGCGGGCGTCGGGGGATGGGGG + Intronic
1105259647 13:18769515-18769537 GGGCGGGTGTGGAAGGAAAAGGG - Intergenic
1105262323 13:18788832-18788854 GGGCGGGTGTGGAAGGAAAAGGG - Intergenic
1105546616 13:21355452-21355474 GGGAGGGGGAGGAGGGAAGGTGG + Intergenic
1105829004 13:24147750-24147772 CTAGGGGTGTGGAGGGAACGGGG - Intronic
1106234903 13:27853467-27853489 AGGAGGGTGTGGACGGAGGGAGG - Intergenic
1106523139 13:30516016-30516038 CCGGGGGTGAGGGGGGAAGGTGG - Intronic
1106912630 13:34479163-34479185 AGGCAGGTGTGGGGGGAGGGAGG + Intergenic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1108552782 13:51563245-51563267 CAGAGGTTGTGGAGAGAAGGGGG + Intergenic
1109053453 13:57514418-57514440 AGGCGGGTTGGGAGGGAGGGAGG + Intergenic
1109241603 13:59896587-59896609 AGGCGGGGGTGGAGGCAGGGGGG + Intronic
1111006347 13:82254846-82254868 CGGGAGGTGTGGAGGGAGGAAGG + Intergenic
1112181972 13:97091921-97091943 CAGAGGCTGGGGAGGGAAGGAGG + Intergenic
1112227664 13:97555904-97555926 CTGCAGGTGTGGATGGATGGTGG + Intergenic
1113483286 13:110637157-110637179 CCGCAGGTGTGGAGGGCAAGGGG + Exonic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113627526 13:111857730-111857752 TGGCGGGTGTTGGGGGATGGGGG + Intergenic
1113781165 13:112978363-112978385 AGGTGGGTGTGGAAGGCAGGAGG + Intronic
1114062329 14:19029472-19029494 CAGGGGGTGTTGTGGGAAGGTGG - Intergenic
1114099930 14:19370521-19370543 CAGGGGGTGTTGTGGGAAGGTGG + Intergenic
1114673492 14:24427212-24427234 TGGCTGGTGAGGAAGGAAGGAGG - Exonic
1114725919 14:24937137-24937159 CGGCGGGTGAGGGTGGAGGGAGG + Intronic
1115229619 14:31145961-31145983 TGGAGGGTGTGGAGTGAGGGTGG - Intronic
1115282236 14:31677318-31677340 TGGTGGGGGTGGAGGGAATGGGG - Intronic
1116015822 14:39405496-39405518 GGGGGGGTGTGGAGGCATGGTGG + Intronic
1116096412 14:40375710-40375732 CGGTGGGTGTTGAGGGATTGTGG + Intergenic
1116475226 14:45331500-45331522 GGGAGGGAGGGGAGGGAAGGAGG - Intergenic
1116928613 14:50668064-50668086 CGGCGGCTCGGGAGGGAAGGAGG - Exonic
1117297533 14:54393447-54393469 CGGGTGGTGTGGAGGGAGAGCGG + Intergenic
1117702523 14:58427674-58427696 GGGCGGGTTTGAAGGGAAGTGGG + Intronic
1118890804 14:69907081-69907103 CCTCTGGTGTAGAGGGAAGGAGG + Intronic
1118906705 14:70028697-70028719 TGGAGGGAGTGGAGGAAAGGTGG + Intronic
1119115280 14:72014822-72014844 AGACGGGTATGGAGGGAAGCGGG - Intronic
1119703166 14:76768743-76768765 GGGCACGTGTGAAGGGAAGGGGG - Intronic
1120604246 14:86552962-86552984 TGGAGGGTGTGGTGGGAGGGGGG + Intergenic
1120969060 14:90192287-90192309 CAGCGGGAGTGGGGGGCAGGAGG + Intergenic
1121277327 14:92677251-92677273 GGGAGGATGTGGTGGGAAGGAGG - Intronic
1121843247 14:97151902-97151924 AGGCGGGCGTGCAGGGAAGAAGG - Intergenic
1122074088 14:99224598-99224620 AGGCCGGTGGGAAGGGAAGGAGG - Intronic
1122437927 14:101712022-101712044 CGGTGGGTGGGGAGAGATGGTGG - Intergenic
1122606239 14:102948677-102948699 GGGTGGGTGTGGAGGTGAGGGGG + Intronic
1122769807 14:104092945-104092967 AGGAGGGTGGGGAGGGAAGGTGG - Intronic
1122903174 14:104790343-104790365 CTGGGGGTGGGGAGGGAGGGAGG - Intronic
1122975351 14:105168604-105168626 CGGCGGGCGTGCAGGGGCGGCGG + Exonic
1124216163 15:27808533-27808555 TGCATGGTGTGGAGGGAAGGTGG + Intronic
1124439161 15:29674703-29674725 CCGGGGGGGCGGAGGGAAGGAGG + Intergenic
1124575402 15:30903693-30903715 CTGCGGGTGGGAAAGGAAGGAGG + Intergenic
1124685755 15:31780485-31780507 CGGCGGGAGCTGTGGGAAGGTGG + Intronic
1125013359 15:34905096-34905118 TGGGGGGGGTGGGGGGAAGGGGG + Intronic
1125285948 15:38092678-38092700 AGCCAGGTGTGGGGGGAAGGTGG + Intergenic
1125345166 15:38711934-38711956 AGGGGGGTGGGCAGGGAAGGAGG + Intergenic
1126063873 15:44810342-44810364 CGGCGGGGGTGGGGGGGGGGGGG - Intergenic
1126741932 15:51786176-51786198 CGGGGAGTGAGGAGGGGAGGAGG - Intronic
1127581552 15:60343417-60343439 CGCCACGTGTGGAGGGAAGGAGG - Intergenic
1127982720 15:64046375-64046397 CGGCGGGCGCGGCGGGAACGGGG + Intronic
1129450243 15:75647566-75647588 CGGAGGGAGAGGAGGGGAGGTGG + Intronic
1129862522 15:78873413-78873435 CGGCGGGGGGGGAGGGGCGGTGG + Intronic
1130095215 15:80850666-80850688 TTGAAGGTGTGGAGGGAAGGGGG + Intronic
1130472219 15:84235848-84235870 CGCGGGGTGGGGAGGGAAGCGGG - Exonic
1130564490 15:84981957-84981979 CGGCGGCTGCGGTGGGAAGGGGG - Exonic
1130830671 15:87595264-87595286 TGGCGGGTGGGTAGGGAAAGAGG + Intergenic
1130908585 15:88256246-88256268 CGGCGAGGGAGGGGGGAAGGGGG + Intronic
1131055478 15:89372052-89372074 AGATGGGTGTGAAGGGAAGGTGG + Intergenic
1131097138 15:89663329-89663351 TGGGGGGTGGGGAGGGAAGATGG - Intergenic
1131225945 15:90624472-90624494 CAGAGGGTGAGGAGGGAGGGTGG - Intronic
1131431583 15:92393145-92393167 CCGCGAGGGCGGAGGGAAGGCGG + Intergenic
1131631132 15:94177755-94177777 CGCCGGGTGACGAGGGAGGGAGG + Intergenic
1132674130 16:1114673-1114695 CCCCGGGTGTGGAGCGGAGGTGG - Intergenic
1132718351 16:1303502-1303524 GGGCGGGTGAGGTGGGAGGGCGG + Intergenic
1132872449 16:2121934-2121956 GGGCGGGTGTTCAGGGATGGAGG - Intronic
1132974986 16:2706659-2706681 TGGAGGGTGGGGAGGGCAGGGGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133069536 16:3235849-3235871 GGGGGGGTGGGGAGGGTAGGGGG - Intronic
1133069552 16:3235874-3235896 AGGGGGGTGGGGAGGGTAGGGGG - Intronic
1133069562 16:3235891-3235913 AGGGGGGTGGGGAGGGTAGGGGG - Intronic
1133069572 16:3235908-3235930 AGGGGGGTGGGGAGGGTAGGGGG - Intronic
1133324799 16:4936295-4936317 CAGAGGGTGGGGAGGTAAGGGGG + Intronic
1135016516 16:18928284-18928306 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1135406987 16:22206006-22206028 CGGCGGGAGAGGACGGAAGTTGG + Intergenic
1135597464 16:23755133-23755155 CGGCGGCTGCGGAGGGGACGGGG + Intronic
1136247692 16:28984975-28984997 TGGCGGGTGGGGTGGGAAGGGGG + Intronic
1136318358 16:29466884-29466906 CGGCGGGGTTGGAGTCAAGGCGG - Exonic
1136333633 16:29597264-29597286 CGGAGGGTAGGGAGGGAGGGAGG + Intergenic
1136432933 16:30206233-30206255 CGGCGGGGTTGGAGTCAAGGCGG - Exonic
1137578792 16:49621117-49621139 CGGAGGGGGTGAAGGGGAGGTGG + Intronic
1138028780 16:53542547-53542569 TGGCAGGTGTTGTGGGAAGGCGG + Intergenic
1138128655 16:54459670-54459692 CGGCGGGCGTTGAGGGGTGGTGG - Intergenic
1141081978 16:81060793-81060815 CGGCCAGCATGGAGGGAAGGAGG + Intronic
1141163938 16:81647906-81647928 CTGCGGGTGCGGGGGGAGGGTGG - Intronic
1141163950 16:81647938-81647960 CTGCGGGTGCGGGGGGAGGGTGG - Intronic
1141163962 16:81647970-81647992 CTGCGGGTGTGGGGGGAGGGTGG - Intronic
1141163974 16:81648002-81648024 CTGCGGGTGCGGGGGGAGGGTGG - Intronic
1141236364 16:82221462-82221484 CAGAGGCTGGGGAGGGAAGGAGG - Intergenic
1141721730 16:85759756-85759778 AGGCGGGTGTGGAAGCAAAGTGG + Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142322674 16:89394276-89394298 TGGCAGGTGTGGAGGAGAGGCGG - Intronic
1142431300 16:90029279-90029301 AGGCAGGTGGGGAGGGATGGGGG + Exonic
1142676791 17:1518410-1518432 AGGTGGGTGAGGAGGAAAGGGGG + Exonic
1142743790 17:1945008-1945030 CTGCGGCTGGGGAGGGAAGGAGG - Intronic
1142762144 17:2049042-2049064 AGCCGGGTGGGGAGTGAAGGAGG + Intergenic
1142856159 17:2731491-2731513 CGGGGGTTGGGGAAGGAAGGCGG + Intergenic
1143476395 17:7205881-7205903 AGGTGGGTGTGCTGGGAAGGAGG - Intronic
1143583193 17:7838288-7838310 CTGCTGGTGGGGAGGGAGGGAGG + Intergenic
1143720766 17:8807497-8807519 TGGAGGATGTGGAAGGAAGGGGG + Intronic
1144851176 17:18244719-18244741 CGGCGGGGGGGGGGGGCAGGGGG + Exonic
1145272047 17:21410030-21410052 AGGCTGGTGTGGAGGGGAGAGGG - Intronic
1145310256 17:21697493-21697515 AGGCTGGTGTGGAGGGGAGAGGG - Intronic
1146552365 17:33792339-33792361 AGCCGGGAGTGGAGGGAATGGGG - Intronic
1146556351 17:33827870-33827892 TGTCGGGAGTGGAGGGAAAGAGG - Intronic
1146683908 17:34827630-34827652 CGGAGGGTCTGGAGGAAGGGGGG - Intergenic
1146902961 17:36600218-36600240 TGAAGGGTGGGGAGGGAAGGAGG - Exonic
1147134703 17:38428332-38428354 CGGGGTGGGTGGTGGGAAGGGGG + Intergenic
1147384489 17:40073201-40073223 AGGCAGGTGTGGCGGGTAGGAGG - Intronic
1147565734 17:41535491-41535513 TGGCAGGAGGGGAGGGAAGGGGG + Intergenic
1148261433 17:46187104-46187126 CAGAGGGTGTGAAGGGAAAGAGG - Intronic
1148564857 17:48626719-48626741 CGGCGGGGGCGGAGGAGAGGCGG + Intronic
1148737824 17:49874663-49874685 AGGTGGGCGTGGAGGGGAGGGGG - Intergenic
1148864217 17:50620155-50620177 CTTAGGGGGTGGAGGGAAGGAGG + Intronic
1148876485 17:50690334-50690356 CGGCGGGAGGGGAGGGGGGGCGG + Intronic
1149856697 17:60088931-60088953 GGGCGGGTGTGGTGGGTCGGGGG - Intergenic
1150060499 17:62065103-62065125 CGGCGGGCGCCGAGGGAGGGGGG - Intronic
1150152035 17:62817866-62817888 GGGAGGGGGTGGAAGGAAGGAGG + Intergenic
1150266478 17:63835377-63835399 GGGAGGTTCTGGAGGGAAGGAGG - Intronic
1150293110 17:63993122-63993144 AGGAGGGAGGGGAGGGAAGGAGG + Intergenic
1150578974 17:66454986-66455008 AGGCAGCAGTGGAGGGAAGGTGG + Intronic
1151175296 17:72283455-72283477 GGGGGGGTGGGGCGGGAAGGTGG - Intergenic
1151182026 17:72336215-72336237 AGGGGAGGGTGGAGGGAAGGAGG - Intergenic
1151580466 17:74974779-74974801 GAGCGGGTGTGGAGGGAAAGAGG + Intergenic
1151606806 17:75142642-75142664 AGGGGGGGATGGAGGGAAGGGGG + Intronic
1151658094 17:75504920-75504942 GGGTGGGTGCGGAGGGGAGGCGG + Exonic
1152008032 17:77694721-77694743 CAGGGAGTGGGGAGGGAAGGAGG - Intergenic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152312072 17:79557522-79557544 CGGCGGTGGTGGGGGGAAAGGGG + Intergenic
1152320819 17:79608202-79608224 AGGCGGATGTCGAGGGAAGGTGG - Intergenic
1152352751 17:79792513-79792535 AGGCGGGAGAGAAGGGAAGGCGG + Exonic
1152628543 17:81399428-81399450 CGGCGGGGGTGGGGGGTGGGGGG + Intronic
1152901935 17:82947316-82947338 GTGGGTGTGTGGAGGGAAGGTGG - Intronic
1153285102 18:3449791-3449813 CGGGGGTGGAGGAGGGAAGGAGG + Intronic
1153837059 18:8972830-8972852 GGGAGGTTGTGGAGGGGAGGTGG - Intergenic
1154259798 18:12820693-12820715 CCGCGTGTGTGTAGGGAGGGGGG - Intronic
1154424951 18:14264976-14264998 AGGCGGGTGAGGAGGGTTGGGGG + Intergenic
1155074462 18:22342540-22342562 AGGCGGGGGTGGGGGGGAGGGGG - Intergenic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1157816182 18:50730794-50730816 GGCCGGGTGTGGGGTGAAGGGGG - Exonic
1159983397 18:74813462-74813484 TGGTGGGTGTGGGGTGAAGGGGG - Intronic
1160136969 18:76280567-76280589 GGGTGGGTGTGGAGGGACGTGGG - Intergenic
1160204383 18:76821682-76821704 GGGAGGGGGAGGAGGGAAGGAGG + Intronic
1160324475 18:77930718-77930740 TGGAGGGAGTGGAGGGATGGAGG - Intergenic
1160357306 18:78239119-78239141 CGGCGCATGTGGAGGAGAGGAGG + Intergenic
1160691414 19:461975-461997 TGGCAGGTGGGGAGGGAGGGAGG + Intergenic
1160773891 19:846065-846087 TGGTGGGTGTGGTGGGAGGGCGG + Intronic
1160782657 19:884675-884697 CAGCGGGCGTGGAAGGATGGAGG + Intronic
1160790664 19:921837-921859 CGGCGGGAGGGGAGGGGGGGCGG - Intergenic
1160872153 19:1282432-1282454 GGGAAGGTGTGAAGGGAAGGAGG + Intergenic
1160999843 19:1905182-1905204 CGGCGGGAGGGGAGGAGAGGCGG - Intergenic
1161392492 19:4028638-4028660 TGGGGGGCGTGGAGGGAGGGTGG + Intronic
1161952951 19:7477734-7477756 TGGGAGGTGTGGAGGGAAGGGGG + Intronic
1162761516 19:12891408-12891430 TCGGGAGTGTGGAGGGAAGGAGG + Intronic
1162964517 19:14149575-14149597 GGGCCGGTGGGGAGGGAAGGGGG + Exonic
1163113926 19:15178129-15178151 GGTGGGGAGTGGAGGGAAGGAGG + Intronic
1163264109 19:16207993-16208015 TGGCGGTTGGGGAGGGAGGGAGG - Intronic
1163566132 19:18052283-18052305 CGGGAGGTGGGGAGGGGAGGAGG + Intergenic
1163635016 19:18433648-18433670 CGGGGGGGGTGGCGGGGAGGGGG + Intronic
1163845948 19:19638098-19638120 GGGCGAGAGTGGAGGGCAGGGGG + Intronic
1164189573 19:22901797-22901819 CGCGGGCTGTGGTGGGAAGGTGG + Intergenic
1164531485 19:29051656-29051678 TTGAGGGTGTGGAGGGGAGGAGG - Intergenic
1164574165 19:29396093-29396115 CAGGGGGTGGGGAGGGAGGGAGG - Intergenic
1165089105 19:33373538-33373560 CGGCGGGTGTGGCGGGAGCAGGG - Exonic
1165104487 19:33460883-33460905 GGATGGGGGTGGAGGGAAGGTGG + Intronic
1165204618 19:34172841-34172863 CGGAGGGAGGGGAGGGAACGAGG - Intronic
1165349571 19:35268721-35268743 CGGCGGCTGCTCAGGGAAGGAGG + Intergenic
1165489359 19:36114421-36114443 GGGCGAGTGTGGGGGAAAGGGGG + Intronic
1165828756 19:38720157-38720179 TGAGGGGTGTGGAGTGAAGGTGG - Intronic
1165912346 19:39237078-39237100 AGGTGGGAGTAGAGGGAAGGGGG + Intergenic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166197093 19:41214245-41214267 GGGCAGGAGTAGAGGGAAGGTGG - Intergenic
1166361734 19:42255319-42255341 CGGCGGGGGAGGGAGGAAGGAGG + Intergenic
1167230397 19:48279446-48279468 GGGCGGGGGTGGGGGGATGGGGG + Intronic
1167368017 19:49064876-49064898 CCTCGGGTGGGGAGGGACGGGGG - Intronic
1167487206 19:49769605-49769627 GGGCGGGTGTGGAGGGGAGTGGG + Intronic
1167642423 19:50688987-50689009 CGGCGGGGTCGGAGGGGAGGGGG + Intronic
1168274445 19:55269391-55269413 CGGCGAGGGTGGGTGGAAGGTGG - Intronic
1168336513 19:55600330-55600352 CGGCGCGTGGGAAGGGGAGGGGG - Intronic
1202683839 1_KI270712v1_random:31288-31310 CGGCGGGGGGGGAGGGGTGGGGG - Intergenic
925718670 2:6807859-6807881 CTGGGGGTGTGGAGGTAAAGGGG - Intergenic
925818366 2:7775399-7775421 GGGGGGTTGTGGGGGGAAGGAGG + Intergenic
925948307 2:8887253-8887275 AGGGGGTGGTGGAGGGAAGGAGG - Intronic
926718074 2:15940479-15940501 CGGGGGGCGGGGAGAGAAGGGGG - Intergenic
927661950 2:25000879-25000901 CGGAGGCTGTGCAGGGGAGGTGG + Intergenic
927846050 2:26473477-26473499 CATCGAGTGTGCAGGGAAGGGGG - Exonic
927928152 2:27027110-27027132 CAGGGGGTGGGGAGGGCAGGTGG - Exonic
928098876 2:28423308-28423330 CTGCAGGTGTGCAGGAAAGGTGG + Intergenic
928613099 2:33010011-33010033 TGGAGGGTGGGGAGAGAAGGAGG + Intronic
929126598 2:38528214-38528236 CGGCGGGGGAGGAGGGGAGCCGG - Intergenic
930851511 2:55965936-55965958 AGGTGTGTGTGAAGGGAAGGAGG + Intergenic
930928547 2:56851705-56851727 AGGCGTGGGAGGAGGGAAGGAGG - Intergenic
931632453 2:64313193-64313215 GGGCGGGGGGGGAGGGGAGGTGG - Intergenic
932398954 2:71466584-71466606 CGGCGGGCGGGGAGGGACAGGGG - Intronic
932701330 2:73993979-73994001 CTGTGGGTGTGGTGGGTAGGTGG + Intronic
933727463 2:85434966-85434988 CTGCGGGGGTGGGGGGTAGGAGG - Exonic
933927307 2:87106050-87106072 CAGGGAGTGTGGAGGGAGGGAGG - Intergenic
934033226 2:88066432-88066454 CGGCGGGGGTGGGGGGCAGTGGG - Intergenic
934676710 2:96254443-96254465 AGGCGGGTCTGTAGGGAAGCAGG + Intronic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935956852 2:108385549-108385571 GGGCGGGTGGGGAAGGAAAGTGG - Intronic
936377158 2:111951134-111951156 CGGGGGGCGGGGAGGGAGGGAGG + Intronic
936462889 2:112725054-112725076 TGGGGGGTGTGGGAGGAAGGAGG - Intronic
936836425 2:116715805-116715827 CAGAGGGTGGGAAGGGAAGGAGG + Intergenic
937106732 2:119322850-119322872 TGGGGGGTGGGGAGGGCAGGGGG + Intronic
937216101 2:120314600-120314622 AGGAGGCTGGGGAGGGAAGGAGG - Intergenic
937319784 2:120954273-120954295 CGGAAGGTTTTGAGGGAAGGTGG + Intronic
937339164 2:121079968-121079990 CTGAGGGTCTGGAGGGTAGGAGG + Intergenic
938271895 2:129979861-129979883 CCGCGGCTGGGAAGGGAAGGAGG - Exonic
938444106 2:131363939-131363961 CCGCGGCTGGGAAGGGAAGGAGG + Intergenic
939108485 2:137977911-137977933 TGGGGGGTGGGGAGGCAAGGTGG - Intronic
939110360 2:137999403-137999425 TGGTGTGTGTGGAGGGAAGGAGG - Intronic
939411739 2:141835494-141835516 TGGGGGGAGGGGAGGGAAGGTGG + Intronic
942307316 2:174621492-174621514 CGATGGGGGTGGAGGGGAGGGGG - Intronic
942484942 2:176429036-176429058 CCCCACGTGTGGAGGGAAGGAGG + Intergenic
942546308 2:177067643-177067665 GGGTGGGGGTGGAGGGATGGGGG + Intergenic
943046659 2:182868135-182868157 GGGCGGGGGTGGGGGGAAGAGGG - Intergenic
943751737 2:191516343-191516365 GAGCGGGTGGGGAGAGAAGGAGG + Intergenic
944474544 2:200090260-200090282 CGGGAGATGTGGAAGGAAGGTGG - Intergenic
944661095 2:201922622-201922644 CGGTGGTTGTGGAGGGGAGTGGG - Intergenic
944762491 2:202831423-202831445 AGTTGGGAGTGGAGGGAAGGAGG - Intronic
945033664 2:205686361-205686383 AGGCGGCTGGGGAGGGGAGGCGG - Intronic
946174836 2:217916285-217916307 TGGGGGGTCTGGAGGGGAGGAGG - Intronic
946227099 2:218269874-218269896 AGTCGGGTGTGGAGGGGAGCGGG + Intronic
946952966 2:224897541-224897563 AGGCTGGGGTGGAGGGGAGGTGG - Intronic
947442639 2:230136603-230136625 GGGCAGGTGTGGGGGGCAGGTGG + Intergenic
947740250 2:232481672-232481694 TGGTGGGTGGGGAGGGGAGGGGG - Intronic
947805775 2:232966865-232966887 AGGCGGGTGAGGAGCTAAGGTGG + Intronic
947811875 2:233009874-233009896 CAGGTGGAGTGGAGGGAAGGTGG - Intronic
948079187 2:235191600-235191622 CGGGGGGTGAGGTGGGGAGGAGG - Intergenic
948269851 2:236665937-236665959 CCGAGGGCGTGGTGGGAAGGGGG - Intergenic
948571916 2:238923014-238923036 CTGCAGGTGGGGAGGGAAGCAGG - Intergenic
948759808 2:240183606-240183628 AGGAGGGTGTGTGGGGAAGGTGG - Intergenic
948796174 2:240402980-240403002 CGGTGGCTGTGGAGGGGTGGGGG + Intergenic
948929087 2:241119259-241119281 CGGAGGGTGGGGAGGGAGGTGGG + Intronic
1168744072 20:221336-221358 GGGAGGGAATGGAGGGAAGGAGG + Intergenic
1168803693 20:660742-660764 AGAGGGGTGTGAAGGGAAGGCGG + Intronic
1169044581 20:2525272-2525294 TGGCGGGTGCGGAGGGAACGGGG - Intergenic
1170669219 20:18415323-18415345 CGGCTGGTGTGGAGCCATGGTGG - Exonic
1171978025 20:31607656-31607678 CTGCGGGTCTGGAGTGAAGGTGG + Intergenic
1172109839 20:32538383-32538405 CGGCGGGTGTCTGGGGCAGGAGG + Intronic
1172324943 20:34027106-34027128 CGGGGGATGTGGAGGGAGTGGGG - Intronic
1172586098 20:36085985-36086007 TGGTGGGTGGGGAGGGGAGGTGG + Intergenic
1172863493 20:38076648-38076670 GGGCAGGGGTGGGGGGAAGGGGG - Intronic
1173172599 20:40739701-40739723 AGGCAGGTGTGGAGGGAGGCGGG - Intergenic
1173327953 20:42050750-42050772 AGGCGGGTGAGGAGTGAAGTTGG + Intergenic
1173603072 20:44309935-44309957 GGGTGGGTGAGGAAGGAAGGTGG + Intronic
1174743626 20:53040331-53040353 TGGCTGGTGTGGAGGGAGGAGGG + Intronic
1174842722 20:53915431-53915453 ACGCGGGGGTGGGGGGAAGGTGG - Intergenic
1175262118 20:57681289-57681311 CGGCAGGTTTGGAGGGACGGGGG - Intronic
1175293334 20:57892821-57892843 CGGAGGGTGTGCAGGGATGGAGG - Intergenic
1175482394 20:59320822-59320844 TGGGGGTTGTGGAGGGCAGGGGG + Intronic
1175958463 20:62623191-62623213 CGGAGGCTGTGGAGGGAGGACGG - Intergenic
1175975148 20:62707374-62707396 CGCAGGGTGTTGAGGGAAGCGGG - Intergenic
1176116508 20:63433964-63433986 GGCCGGGCGTGGAGGGAACGGGG + Intronic
1179359239 21:40689968-40689990 CAGCCAGTGTGGAGGGAGGGAGG + Intronic
1179411503 21:41167206-41167228 GGGCGGGGGTGGGGGGAAGGTGG + Intergenic
1179457137 21:41507711-41507733 CGGGGGCCGTGGAGGGCAGGCGG + Intronic
1179608079 21:42531176-42531198 CGACGAGTGTGCGGGGAAGGCGG - Intronic
1179608090 21:42531219-42531241 CGACGAGTGTGCGGGGAAGGCGG - Intronic
1179682349 21:43032309-43032331 CGGAGGGTGGTGAGGGAAGGAGG - Exonic
1179837719 21:44048322-44048344 CAGAGGGTGGGGAGGGCAGGGGG - Intronic
1180081654 21:45490119-45490141 CAGGGGCTGTGGAGGGATGGAGG - Intronic
1180480822 22:15752099-15752121 CAGGGGGTGTTGTGGGAAGGTGG - Intergenic
1181552037 22:23645365-23645387 CCACAGGTGGGGAGGGAAGGAGG - Intergenic
1181618012 22:24068205-24068227 AGAAGGGGGTGGAGGGAAGGAGG + Intronic
1181690151 22:24554828-24554850 AGGCGGGTGTGGGGGCGAGGCGG + Intronic
1181758732 22:25043108-25043130 TGGGGGGTGGGGAGGAAAGGAGG + Intronic
1182358821 22:29734936-29734958 CCGCGGGAGCAGAGGGAAGGTGG + Intronic
1182549633 22:31093817-31093839 CGGCGGGTGCTGAAGGCAGGTGG - Intronic
1183208405 22:36434778-36434800 CCGGCTGTGTGGAGGGAAGGGGG + Intergenic
1183315343 22:37133937-37133959 TGGGGGGTGTGGAGGGGATGGGG - Intronic
1183440315 22:37819179-37819201 GAGCGGAGGTGGAGGGAAGGAGG - Intergenic
1184148722 22:42626529-42626551 TGGCTGGTGTGGAGGGAGAGAGG - Intronic
1184186767 22:42870026-42870048 CGGCGGGGGTGGGGGGAACGTGG - Exonic
1184286227 22:43473236-43473258 GGGAGGGTGAGGAGTGAAGGGGG + Intronic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184407175 22:44306811-44306833 CGGCGTGTGTGGAGGGGACCTGG + Intronic
1184515617 22:44960264-44960286 AGGTAGCTGTGGAGGGAAGGGGG - Intronic
1184561934 22:45268597-45268619 GGGCGGGTGAGGAGTGACGGGGG - Intergenic
1184617602 22:45648618-45648640 CAGGGGGTGTGGTGGGACGGAGG - Intergenic
1184867621 22:47210194-47210216 CGGCTGGTGTGGGAGGAATGAGG - Intergenic
1184889086 22:47368615-47368637 TGGCGGGCATGGAGGGAAAGGGG - Intergenic
1185070643 22:48654004-48654026 CGGCGGCTCTGGAGGGAAGGGGG + Intronic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
1185372685 22:50468325-50468347 TGGCAGGTGGGGAGGGCAGGTGG - Intronic
949386644 3:3509921-3509943 CAGGGGGTGGGGAGAGAAGGGGG + Intergenic
950462878 3:13135647-13135669 CGGAGTGGGTGGAGAGAAGGGGG + Intergenic
950564900 3:13763079-13763101 TGGAGGATGTGGAGGGAAGCAGG - Intergenic
952132949 3:30385294-30385316 GGGGCAGTGTGGAGGGAAGGGGG + Intergenic
953279206 3:41536435-41536457 TGGGGGGTGTGGAGGGCAGTTGG - Intronic
953526237 3:43691630-43691652 GGGCGGGGGTGCCGGGAAGGAGG + Intronic
953631909 3:44625167-44625189 GGGTGGGCGTGCAGGGAAGGCGG + Intronic
953694328 3:45146081-45146103 CGGAGGGTGCGGAGAGAGGGCGG - Intronic
953759297 3:45674253-45674275 CGTGGGGTGGGGAGGGAAGAGGG - Intronic
953807840 3:46086662-46086684 GGGCGGGTGTGGGAGGATGGTGG - Intergenic
954277895 3:49554430-49554452 GGGGGCGTGTGCAGGGAAGGGGG + Intergenic
954411879 3:50374380-50374402 AGGTGGGTGGGGAGGGGAGGGGG + Intronic
954569144 3:51626060-51626082 CGGCGGGGTTGGAGGGCTGGTGG - Intronic
954594598 3:51813985-51814007 CGGGGGCTGTGGGGGGATGGTGG + Intergenic
954709737 3:52499540-52499562 GGGCAGGTGTGGTGGGAAAGAGG - Intronic
955915316 3:63901971-63901993 CGGGGGTTGGGGAGGGAATGTGG + Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
958026875 3:88059206-88059228 CGGCTAGGGAGGAGGGAAGGGGG + Intronic
958502993 3:94938027-94938049 CGGCGGGTGGGGAAGGCAGCCGG + Intergenic
958799411 3:98738085-98738107 AGGCGGGGGTGGGGGGAGGGCGG - Intronic
958815669 3:98911875-98911897 CGGAGGGTGTGGGTGGGAGGAGG + Intergenic
958875656 3:99613777-99613799 GGGCGGGTGGGGAGGGGTGGGGG - Intergenic
959567600 3:107848614-107848636 CGGCAGGGGTGGAGTGGAGGAGG + Intergenic
959781119 3:110234295-110234317 GGGGGTGGGTGGAGGGAAGGGGG + Intergenic
961369152 3:126419041-126419063 CGGCGGGGGAGGAGGGATGGGGG - Intronic
961569046 3:127785193-127785215 CAGCAGGTGTGTGGGGAAGGAGG - Intronic
961930332 3:130526342-130526364 TGGCTGGAGTGGAGGGAATGAGG + Intergenic
962269570 3:133967967-133967989 GGGGGGGTGTGGAGGTGAGGAGG - Intronic
962714708 3:138115993-138116015 TGGGGGCTGCGGAGGGAAGGTGG - Intergenic
965641077 3:170829579-170829601 TGGGGGGTGTCTAGGGAAGGTGG - Intronic
967882659 3:194312963-194312985 CTGCTGGTGGGAAGGGAAGGAGG - Intergenic
968381883 4:103460-103482 AGGAGGGTGAGGAGTGAAGGTGG - Intergenic
968642441 4:1721371-1721393 CGGGGGGTGGGGGGGGAGGGAGG + Intergenic
968937139 4:3617346-3617368 GGGAGGGAGGGGAGGGAAGGAGG - Intergenic
969462253 4:7334950-7334972 AGACGGGTGTGGAGGGAGGGAGG + Intronic
969512858 4:7629562-7629584 CAGCGGGTGGGGAGCGAGGGGGG - Intronic
969586392 4:8096709-8096731 CAGGGGCTGGGGAGGGAAGGGGG + Intronic
970141644 4:12989332-12989354 CGGCGGGGATGGGGGGCAGGGGG + Intergenic
971041943 4:22763564-22763586 CGGCAGGGGTGGGGGGACGGGGG + Intergenic
971219189 4:24689490-24689512 CAGTGGGAGTGGAGGGATGGTGG - Intergenic
971743228 4:30546630-30546652 CGCCACCTGTGGAGGGAAGGGGG - Intergenic
972415801 4:38839135-38839157 GGGAGGGAGGGGAGGGAAGGGGG + Intronic
973774767 4:54233059-54233081 GGGCGGGTGTGGAGAGAGGGGGG - Intronic
975101841 4:70522538-70522560 GGGATGGTGTGGAGGGAAGGGGG - Intronic
975172950 4:71253807-71253829 CTGCGTGTGTGTTGGGAAGGAGG + Intronic
976158105 4:82169501-82169523 TGGCGGGTGGGGAGAGAAGTGGG + Intergenic
976246485 4:83010839-83010861 GGGCGGGCGGGGAGGGGAGGAGG - Intronic
976410313 4:84705921-84705943 GGGCGGGGGTGGAGGGAGGGAGG - Intronic
976778387 4:88731287-88731309 CGGCGGGGGGGAAGGGAGGGTGG + Intronic
977526415 4:98151615-98151637 TGGTGGATGTGGAGGGGAGGGGG + Intergenic
977555910 4:98487151-98487173 AGGGGGGGATGGAGGGAAGGAGG + Intronic
977809940 4:101346989-101347011 CGGCGGAGGAGGAGTGAAGGCGG - Exonic
977997989 4:103517676-103517698 AGGCAGGAGAGGAGGGAAGGAGG - Intergenic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
980988505 4:139718392-139718414 AGGCTGGTGTGGAGGCAAGGAGG + Exonic
981067208 4:140498028-140498050 CGGCGGGTGCGGAGGCGATGCGG - Intronic
981113412 4:140960818-140960840 GCGCAGGTGTGGGGGGAAGGTGG + Intronic
981191462 4:141869875-141869897 CGGAAGGTATGTAGGGAAGGAGG - Intergenic
981366672 4:143912162-143912184 CGGCGGCTCCGGAGGGAAGGAGG - Intergenic
983144467 4:164196810-164196832 TGGGGGTTGTGGAGGGAGGGAGG - Intronic
983644532 4:169976562-169976584 GTGCAGGTGTGGTGGGAAGGGGG + Intergenic
985025702 4:185737318-185737340 CAGGGGGTGTGGAGAGCAGGTGG + Intronic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
985703269 5:1386273-1386295 CGGCGGGTGTGGGGGGCACAAGG - Intergenic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
986347191 5:6846253-6846275 CTTCGGGGGTGGAGGGGAGGGGG - Intergenic
987232937 5:15913930-15913952 CGGGGGTTGGGGAGGGCAGGGGG + Intronic
988428103 5:31087573-31087595 GGGTGGGTGGGGAGGGGAGGAGG - Intergenic
988491122 5:31706421-31706443 GGGCTGGTGTGCAGGGGAGGCGG + Intronic
988556690 5:32242678-32242700 CGGGGTGTGGGAAGGGAAGGTGG - Intronic
991930603 5:71749822-71749844 GGGAGGATGTGGAGGGAGGGAGG + Intergenic
992837488 5:80654933-80654955 CGGCAGCTGGGGCGGGAAGGCGG - Exonic
993195779 5:84743606-84743628 TGGGGGCTGGGGAGGGAAGGAGG - Intergenic
995815002 5:116158153-116158175 CGGAGGGAGAGGAGGGAGGGAGG - Intronic
996339219 5:122417721-122417743 GGGGAGGTGGGGAGGGAAGGAGG - Intronic
996801061 5:127403570-127403592 GGGAGGGTGTGGAGGAAATGGGG - Intronic
997162062 5:131619314-131619336 CGGCGGGGCTGGAGGGCGGGGGG + Intronic
1000210685 5:159104234-159104256 TGGCAGGTGGCGAGGGAAGGGGG - Intergenic
1000285174 5:159820444-159820466 TGGAGGGTGAGGAGGGCAGGGGG - Intergenic
1000658808 5:163914987-163915009 AGCAGGGTGTGGAGGGATGGGGG - Intergenic
1000930615 5:167246772-167246794 CGCGGGGTGTGGATGGGAGGAGG + Intergenic
1001891712 5:175344780-175344802 AGGCAGGAGTGGGGGGAAGGAGG + Intergenic
1002406989 5:179042453-179042475 GGGAGGGTGAGGAGGGAAGTAGG + Intergenic
1002645294 5:180649694-180649716 CGGCGGGCTGGGAGGGACGGGGG - Intergenic
1002739593 5:181425330-181425352 CGGCTGTTCTGCAGGGAAGGAGG + Intergenic
1005200947 6:23343165-23343187 GGGAGGGTGTGGAGGGTTGGTGG - Intergenic
1005327762 6:24719797-24719819 CTGCGGGGGTGGAAGGCAGGTGG - Exonic
1005635991 6:27753526-27753548 AGGTGGGGGTGGAGGGAAAGGGG - Intergenic
1006458717 6:34145884-34145906 GGGCGGGTGTGGAGGGGTGGCGG - Intronic
1006694543 6:35920553-35920575 GGGCGAATGTGGAGGAAAGGAGG + Intronic
1006739611 6:36297970-36297992 TGGCGGGGGGTGAGGGAAGGTGG - Intronic
1006783039 6:36645091-36645113 CGTCTGGTGTGGAGGAAAGAGGG - Intergenic
1006914399 6:37585209-37585231 AGGAAGGTGGGGAGGGAAGGTGG - Intergenic
1007079903 6:39092587-39092609 GGGAGGGTGGGTAGGGAAGGAGG - Intergenic
1007100054 6:39239837-39239859 AGGCGGGTGGGGAAGGGAGGAGG + Intergenic
1007279132 6:40697419-40697441 CGGAGAGGGTGTAGGGAAGGTGG + Intergenic
1007390168 6:41546310-41546332 AGGAGGGTGGAGAGGGAAGGAGG - Intergenic
1007478833 6:42136808-42136830 CGACTGGAGTGGAGGGGAGGAGG + Intronic
1008053935 6:46927296-46927318 CGGCGGGGGTGGGTGGAGGGGGG + Intronic
1008205134 6:48646434-48646456 AGGCTGGTGGGGAGGGAAAGGGG - Intergenic
1008957640 6:57233584-57233606 GGGAGGGGGAGGAGGGAAGGAGG - Intergenic
1009279449 6:61728289-61728311 GGGGGGTTGTGGAGGGAGGGAGG + Intronic
1010176502 6:73033717-73033739 GGGTGGGTATGGGGGGAAGGGGG - Intronic
1010776214 6:79888979-79889001 AGACGGGGGGGGAGGGAAGGAGG + Intergenic
1012398959 6:98828852-98828874 CGGCGGTTGGGGGGGGATGGGGG - Intergenic
1013163144 6:107565494-107565516 TGGCGGCTGGGGAGGGACGGGGG + Intronic
1013878216 6:114860617-114860639 GTGGGGGTGTGGAGGGTAGGGGG + Intergenic
1014513462 6:122353966-122353988 GGGGGGGTGGGGAGGGCAGGGGG + Intergenic
1015843655 6:137496905-137496927 CGGGGGGAGGGGAGGGAAGGAGG + Intergenic
1016934709 6:149441126-149441148 GGGCTGGTGTGCAAGGAAGGAGG - Intergenic
1018638297 6:165884073-165884095 GGGAGGGTGTGCAGAGAAGGAGG + Intronic
1018721266 6:166574310-166574332 CTGCTGGGGAGGAGGGAAGGAGG - Intronic
1018937175 6:168281104-168281126 CCACGGGTGGGGAGGGAAGGCGG + Intergenic
1019059023 6:169242621-169242643 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059029 6:169242638-169242660 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059035 6:169242655-169242677 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059049 6:169242696-169242718 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059077 6:169242778-169242800 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059086 6:169242803-169242825 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059109 6:169242869-169242891 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059122 6:169242911-169242933 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059168 6:169243050-169243072 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019059216 6:169243192-169243214 AGGTGGGAGTGGTGGGAAGGTGG - Intronic
1019244709 6:170700917-170700939 CGGCTGTTCTGCAGGGAAGGAGG + Intergenic
1019272659 7:159177-159199 AGGGGGCTGGGGAGGGAAGGTGG - Intergenic
1019335732 7:481648-481670 GGGAGGGTGGGGAGGGGAGGAGG - Intergenic
1019346519 7:533423-533445 AGACGTGGGTGGAGGGAAGGAGG + Intergenic
1019406148 7:885300-885322 CAGCAGGCGTGGAGGGCAGGAGG - Intronic
1019455465 7:1124559-1124581 CGGGGGGTGGGGGGGGAGGGGGG + Intronic
1019523178 7:1469558-1469580 CGGCTGGGGTGGAGGGCAGCCGG + Intergenic
1019563058 7:1667391-1667413 CGGGGGTTGTGGAGGGCAGGGGG + Intergenic
1019619941 7:1987050-1987072 CGGGGGGTGTAGGTGGAAGGTGG - Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1020125471 7:5530528-5530550 CGGCGGGTGTGGACGGGCGGCGG + Exonic
1023040952 7:36172894-36172916 TGGGGGGTGGGGAGGGCAGGGGG + Intronic
1023586870 7:41739814-41739836 AGGAGGGGGAGGAGGGAAGGGGG + Intergenic
1023848541 7:44137903-44137925 GGGCTTGTGGGGAGGGAAGGAGG + Intergenic
1023862998 7:44226797-44226819 GGGGGGGTGTGGGGGGAAGATGG + Intronic
1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG + Intronic
1024440261 7:49408414-49408436 AGGCGGATGGGGTGGGAAGGTGG - Intergenic
1024525254 7:50343158-50343180 GGGAGGGTGGGGAGGGAAGGAGG - Intronic
1025016271 7:55441227-55441249 TGGCTGGGGAGGAGGGAAGGGGG + Intronic
1026662827 7:72317182-72317204 AGGCAGGAGGGGAGGGAAGGAGG + Intronic
1026846719 7:73702809-73702831 GGGCTGGAGTGGAGGGCAGGGGG + Intronic
1026874892 7:73873562-73873584 TGGGGGGTGAGGAGGGAAGCAGG + Intergenic
1026894134 7:74000286-74000308 CGGCGGGTGGGGGGGGGCGGGGG + Intergenic
1027130247 7:75585568-75585590 CTGAGAGTGTGGAGGGGAGGGGG - Intronic
1027173827 7:75890750-75890772 GGGGGGCTGTGGAGGGAGGGTGG + Intergenic
1027232614 7:76281568-76281590 CGGCGGGCGGGGCGGGCAGGCGG + Exonic
1028855134 7:95583061-95583083 CGGGGGCTGGGGTGGGAAGGAGG - Intergenic
1029489224 7:100861369-100861391 CTGCGGGCATGGAGGGGAGGAGG - Intronic
1029813800 7:103074572-103074594 GGGGAGGAGTGGAGGGAAGGCGG - Intronic
1030331866 7:108279625-108279647 GGGTGGGTGGGGAGGGCAGGGGG - Intronic
1031468569 7:122143663-122143685 CTGGGCGTGGGGAGGGAAGGGGG + Intronic
1033220117 7:139522244-139522266 CTGCGGGTGTGGAGGGGGAGGGG + Intergenic
1033270641 7:139930053-139930075 CGGCTGGAGGGGAGGGATGGAGG - Intronic
1034203081 7:149294525-149294547 CGGGGGGCCTGGAGGGAGGGAGG - Intronic
1034313817 7:150111873-150111895 CGCCGGGAGTGGTGGGAAGGGGG - Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034467033 7:151235855-151235877 GGGGAGGTGTGGAGGGCAGGGGG - Intronic
1034564168 7:151900061-151900083 CTTCTGGAGTGGAGGGAAGGAGG - Intergenic
1034699865 7:153086520-153086542 CTGCAGGTGTGGAGGAAAGGAGG - Intergenic
1034793081 7:153988919-153988941 CGCCGGGAGTGGTGGGAAGGGGG + Intronic
1034977846 7:155458412-155458434 CGGCGGCGGTGGAGGGACAGCGG + Exonic
1035021640 7:155804148-155804170 CGCCGGGGCGGGAGGGAAGGAGG - Intronic
1035389818 7:158496917-158496939 GGGAGGGGGTGCAGGGAAGGGGG - Intronic
1035417948 7:158705130-158705152 CGGGCGGTGTTGTGGGAAGGAGG + Intergenic
1035436492 7:158863737-158863759 CCGGGTGTGTGGGGGGAAGGGGG + Intronic
1035503417 8:107271-107293 CGGCTGTTCTGCAGGGAAGGAGG - Intergenic
1035670999 8:1417077-1417099 GGGCGGGGGTGGGGGGATGGGGG + Intergenic
1035757417 8:2044586-2044608 GGTCGGCTGTGGAGGGAGGGAGG - Intergenic
1036282748 8:7415728-7415750 GGGCAGGTGGGGAGGGAGGGAGG - Intronic
1036432153 8:8701838-8701860 CGGTGGGCGGGGAGGGAAAGAGG - Intergenic
1036561544 8:9903762-9903784 CGGAGGGGGTGGAGGGATGGGGG + Intergenic
1036632185 8:10523801-10523823 GGTAGGGTGTGGAGGGGAGGAGG - Intergenic
1036662078 8:10715199-10715221 AGGCAGGTCTGTAGGGAAGGTGG + Intergenic
1036723816 8:11201380-11201402 CGGCGGGGGGGGGGGGAAGAAGG + Intergenic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1036962834 8:13264584-13264606 GAGCGGGAGAGGAGGGAAGGAGG + Intronic
1037339748 8:17831865-17831887 GGGCAGCGGTGGAGGGAAGGTGG - Intergenic
1038307749 8:26420052-26420074 TGGTGGGCGTGGAGGGCAGGAGG - Intronic
1039419164 8:37421244-37421266 TGAAGGGTGGGGAGGGAAGGAGG - Intergenic
1039542128 8:38381566-38381588 TGGGGGGTGTGGAGGGAATTGGG - Intronic
1039936713 8:42051998-42052020 CGGGGGGAGGGGAGGCAAGGCGG + Intergenic
1040941008 8:52833690-52833712 TGGCAGGTGTGTAGGAAAGGGGG - Intergenic
1041009625 8:53529269-53529291 CTGCAGGTGGGGAGGGGAGGAGG + Intergenic
1041677601 8:60551102-60551124 ACGCTGGGGTGGAGGGAAGGAGG - Intronic
1041788621 8:61664747-61664769 GGGCTGGAGAGGAGGGAAGGTGG + Intronic
1042854052 8:73247188-73247210 AGGAGGGTGTGGAGGGTGGGAGG - Intronic
1043388545 8:79769749-79769771 GGGCGGTGGTGGAGGGATGGGGG - Intergenic
1043960678 8:86414884-86414906 GGGCGGGGGTGGGGGGATGGGGG - Intronic
1044441607 8:92230776-92230798 AGGGGGGTGTGGAGGGAGAGGGG + Intergenic
1044866254 8:96574030-96574052 GAGGGGGTGTGGAGGGGAGGGGG - Intronic
1045445354 8:102256762-102256784 TGGGGGTGGTGGAGGGAAGGAGG - Intronic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1047676633 8:127209562-127209584 GGGAGGGTGGGGAGGGAAGATGG + Intergenic
1048703706 8:137125349-137125371 GGGGTGGTGTGGAGGGAGGGAGG - Intergenic
1049188579 8:141272790-141272812 CTGGTGTTGTGGAGGGAAGGGGG - Intronic
1049632238 8:143665039-143665061 CGGGCGCTGTGGAGGGCAGGAGG - Intergenic
1049643315 8:143725162-143725184 GGGGGGGGGGGGAGGGAAGGAGG + Exonic
1049997776 9:1047796-1047818 AGACGGGTGTGTAGGGAGGGTGG + Intergenic
1051459372 9:17294867-17294889 CGGAGGGAGTGGGGGGAGGGGGG + Intronic
1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG + Intergenic
1052968789 9:34363717-34363739 CGGCGGGAGGGGACGGAAAGTGG - Intergenic
1054454005 9:65420326-65420348 GGGAGGGAGGGGAGGGAAGGAGG + Intergenic
1055757302 9:79570900-79570922 CTCCGGGGGTGGAGGGAGGGAGG + Intergenic
1056531179 9:87489232-87489254 AGGAGGGGGTGGAGTGAAGGTGG + Intergenic
1056805792 9:89727616-89727638 AGGGGGGTGTGGAGGGGAGATGG + Intergenic
1057279365 9:93698873-93698895 GGTCAGGTGTGGAGGGAGGGAGG + Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1060139934 9:121201387-121201409 CGCCGGTTGGGGAGGGCAGGAGG + Intronic
1060355600 9:122904860-122904882 CGGCCAGTGTCGAAGGAAGGTGG + Intronic
1061164112 9:128912507-128912529 GGGGGGGTGTGGATGGCAGGGGG + Intronic
1061187180 9:129061349-129061371 GAGCAGGTGTGGAGGGAGGGAGG + Intronic
1061304445 9:129724293-129724315 GGGCTGGGGTGGAGGGGAGGGGG + Intergenic
1061360026 9:130135486-130135508 CGGCTGGTGGAGGGGGAAGGAGG + Exonic
1061450655 9:130665307-130665329 GGGAGGGGGTGGAGGGAGGGCGG + Intronic
1061805647 9:133136312-133136334 GCGCGGGTATGGATGGAAGGAGG + Intronic
1062054292 9:134462983-134463005 CTGCTGGTGTGGTGGGATGGGGG + Intergenic
1062397080 9:136356885-136356907 TGCCGGGTGTGGAGGGCTGGTGG - Intronic
1062432364 9:136531863-136531885 CGGCGGGTGTGATGGGGATGAGG - Intronic
1062517971 9:136945561-136945583 TGGGGGGTGTAGAGGGAAGCAGG + Intronic
1203604899 Un_KI270748v1:50137-50159 CGGCTGTTCTGCAGGGAAGGAGG + Intergenic
1185473225 X:397634-397656 TGGAGGGTGTGGGGGGCAGGAGG - Intergenic
1185592516 X:1286935-1286957 CGGGGAGAGGGGAGGGAAGGAGG + Intronic
1185598694 X:1324487-1324509 GGGAGGGAGGGGAGGGAAGGAGG + Intergenic
1186081043 X:5932136-5932158 CTGGGGGTGTGGAGGGGAAGGGG - Intronic
1186190454 X:7062690-7062712 AGGTGGGTGGGGAGGGAAGCTGG + Intronic
1186927468 X:14350905-14350927 CGGAGGGGCTGGTGGGAAGGTGG + Intergenic
1188747376 X:33862751-33862773 GGGTGGGTGTGGAGGGGAGGTGG - Intergenic
1189178692 X:38982855-38982877 TAGGGGGTGTGGATGGAAGGAGG + Intergenic
1189313452 X:40036230-40036252 GGGAGAGGGTGGAGGGAAGGAGG - Intergenic
1190008006 X:46758664-46758686 CGAGGGGTGTGGAGGGCGGGGGG + Intronic
1190384840 X:49875068-49875090 CGGCGGTTGGGAAGGGATGGGGG - Intergenic
1190823058 X:53992719-53992741 CGGCAGGTGAGGTGGGAAGGAGG - Exonic
1190970387 X:55342557-55342579 CGGCGGGTGGGGAGGGGTGTTGG - Intergenic
1192326048 X:70133343-70133365 AGGCGTGTGTGGGGTGAAGGGGG + Intergenic
1193403687 X:81076915-81076937 CATGGGGTGTGGAGGGCAGGGGG + Intergenic
1194433184 X:93837144-93837166 TGGAGGGTGTGGAGGGTGGGAGG - Intergenic
1194657994 X:96597004-96597026 AGGTGTGTGTGCAGGGAAGGGGG - Intergenic
1197133858 X:123037961-123037983 CAGCGGGTGTGAAGGTAAAGAGG - Intergenic
1197772019 X:130095151-130095173 AGGGTGGTGTGCAGGGAAGGTGG + Intronic
1198958897 X:142162594-142162616 TGGCGGGGGTGGAGGGTGGGAGG + Intergenic
1199698666 X:150361488-150361510 GCGTGGGCGTGGAGGGAAGGAGG + Intronic
1199699503 X:150365098-150365120 CGGCGGGGGTGGGAGGGAGGGGG - Intronic
1199827716 X:151516291-151516313 AGGATGGTGGGGAGGGAAGGAGG + Intergenic
1199970139 X:152853658-152853680 AGGCGGGTGTGGGAGGAAGTGGG - Intronic
1200097131 X:153669686-153669708 CGGCGAGTGTGGAGGGGACCTGG - Intergenic
1202063177 Y:20909807-20909829 TGGTGGGTTTGGAGAGAAGGGGG + Intergenic