ID: 1083179027

View in Genome Browser
Species Human (GRCh38)
Location 11:60972469-60972491
Sequence GGGGGCAGCTTGAGACGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 212}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083179027_1083179037 3 Left 1083179027 11:60972469-60972491 CCCCCACGTCTCAAGCTGCCCCC 0: 1
1: 0
2: 1
3: 12
4: 212
Right 1083179037 11:60972495-60972517 TGTCAAGGCACCTGGCCACCTGG 0: 1
1: 0
2: 4
3: 11
4: 182
1083179027_1083179033 -5 Left 1083179027 11:60972469-60972491 CCCCCACGTCTCAAGCTGCCCCC 0: 1
1: 0
2: 1
3: 12
4: 212
Right 1083179033 11:60972487-60972509 CCCCCAAGTGTCAAGGCACCTGG 0: 1
1: 0
2: 0
3: 7
4: 132
1083179027_1083179040 10 Left 1083179027 11:60972469-60972491 CCCCCACGTCTCAAGCTGCCCCC 0: 1
1: 0
2: 1
3: 12
4: 212
Right 1083179040 11:60972502-60972524 GCACCTGGCCACCTGGGCCAGGG 0: 1
1: 0
2: 5
3: 25
4: 305
1083179027_1083179038 4 Left 1083179027 11:60972469-60972491 CCCCCACGTCTCAAGCTGCCCCC 0: 1
1: 0
2: 1
3: 12
4: 212
Right 1083179038 11:60972496-60972518 GTCAAGGCACCTGGCCACCTGGG 0: 1
1: 0
2: 0
3: 51
4: 918
1083179027_1083179043 20 Left 1083179027 11:60972469-60972491 CCCCCACGTCTCAAGCTGCCCCC 0: 1
1: 0
2: 1
3: 12
4: 212
Right 1083179043 11:60972512-60972534 ACCTGGGCCAGGGAATCAGATGG 0: 1
1: 0
2: 0
3: 34
4: 288
1083179027_1083179046 28 Left 1083179027 11:60972469-60972491 CCCCCACGTCTCAAGCTGCCCCC 0: 1
1: 0
2: 1
3: 12
4: 212
Right 1083179046 11:60972520-60972542 CAGGGAATCAGATGGCCAGAAGG 0: 1
1: 0
2: 0
3: 41
4: 405
1083179027_1083179039 9 Left 1083179027 11:60972469-60972491 CCCCCACGTCTCAAGCTGCCCCC 0: 1
1: 0
2: 1
3: 12
4: 212
Right 1083179039 11:60972501-60972523 GGCACCTGGCCACCTGGGCCAGG 0: 1
1: 1
2: 6
3: 51
4: 401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083179027 Original CRISPR GGGGGCAGCTTGAGACGTGG GGG (reversed) Intronic