ID: 1083179733

View in Genome Browser
Species Human (GRCh38)
Location 11:60977411-60977433
Sequence TGGGGATCCCAGCCCTACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083179733_1083179740 14 Left 1083179733 11:60977411-60977433 CCCTGGTAGGGCTGGGATCCCCA 0: 1
1: 0
2: 3
3: 19
4: 169
Right 1083179740 11:60977448-60977470 CCTCAGCTAGCAAGACCTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083179733 Original CRISPR TGGGGATCCCAGCCCTACCA GGG (reversed) Intronic
900177056 1:1295592-1295614 TGGGGTTCCCTGCCCCACCCCGG - Intronic
900414063 1:2527110-2527132 TGGGGAACCCTGCCCCACCTGGG + Intergenic
900974219 1:6007251-6007273 TGGGGACCCCAGCCACACCCAGG + Intronic
901703683 1:11058922-11058944 GGGGGCTCCCAGTCCTGCCAGGG - Intronic
902634146 1:17724181-17724203 TGGATTTCCCAGCCCCACCATGG - Intergenic
902790636 1:18765492-18765514 TGGAGCTCCCAGCTCTGCCATGG - Intergenic
903030094 1:20457801-20457823 TGGTTTTCCCAGCCATACCATGG + Intergenic
903173934 1:21569708-21569730 CAGGGGTCCCAGCACTACCAAGG - Intronic
903503643 1:23816952-23816974 TTGGGATCTCAGCCAAACCAAGG - Intronic
903549434 1:24147646-24147668 TGGTGTTCCCAACCCAACCAAGG - Intergenic
903830087 1:26169483-26169505 TTGGAATCCCAGCCCCACCAGGG - Intergenic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906195295 1:43926676-43926698 TGGGGTCTCCAGCCTTACCAGGG - Intronic
907665761 1:56432760-56432782 AGGTGATCCCTGCCCTGCCAGGG + Intergenic
911025631 1:93433685-93433707 TCTGGATCCCACACCTACCAAGG + Intergenic
911621712 1:100072964-100072986 TGGGTATCTCAGCCTTAACATGG + Intronic
914509290 1:148317372-148317394 TGGTGGTCCGAGCCCAACCAGGG - Intergenic
915824290 1:159058464-159058486 TGTGTATCCCAGCCCCAGCAGGG + Intergenic
916517072 1:165528460-165528482 TGGTAATCCCAGCACTACTATGG + Intergenic
919992465 1:202718028-202718050 TGTGGATGGCAGCTCTACCATGG - Intergenic
920272487 1:204776423-204776445 TGTGCATCCCAGACCTACTAAGG + Intergenic
922809528 1:228407853-228407875 TGTGGCTCCCAGCCCCCCCAGGG - Intergenic
1062958273 10:1554287-1554309 TGGGGCTCCCAGTCCTTCCCTGG + Intronic
1063705501 10:8426558-8426580 TTTGGATCCCAGTCCTACCAGGG - Intergenic
1064644369 10:17445827-17445849 TGGTGGACCCAGCCCTCCCAGGG + Intronic
1067436582 10:46283033-46283055 TGGGCAGCCCAGCCCTCCCCGGG - Intergenic
1067449873 10:46375711-46375733 TGGGGGTGCAAGCCCTCCCAGGG - Exonic
1072283707 10:93893830-93893852 TGGGCACCACAGCCCGACCAGGG + Intergenic
1074270123 10:111945306-111945328 TGGAGAGCCCAGCCCTACAGGGG + Intergenic
1075632878 10:124011705-124011727 TGTGGATACCAGCCCCCCCAGGG - Intronic
1075644276 10:124087286-124087308 TGGCGATCCCATCCCTCCCAGGG - Intronic
1076825180 10:132963594-132963616 GGGGCATCCCAGCCCTCACAGGG + Intergenic
1077055434 11:590148-590170 TGGGAACCCCAGTCCCACCATGG + Intronic
1077110710 11:860847-860869 GGGGGATCCCTGCCCCACCCTGG - Intronic
1077181815 11:1220300-1220322 TGAGGGTCCCAGCTCTGCCATGG + Intergenic
1077251088 11:1561045-1561067 TGTGGATGCCAGGCCTAGCAGGG + Intronic
1077338062 11:2014230-2014252 TGGGCCTCCCAGCCCTGCAAGGG + Intergenic
1077406861 11:2386609-2386631 TGGTCTTCCCAGCCCTAGCATGG - Intronic
1078659006 11:13269922-13269944 CAGGGATCCCAGCCCAACCAGGG + Intergenic
1079250039 11:18780543-18780565 TGTGGTTTCCAGCCCTTCCAAGG + Intronic
1081584684 11:44376344-44376366 TGGATTTCCCAGCCCTGCCAGGG - Intergenic
1082833864 11:57638512-57638534 TGGGGATCCAAGCCCGGCCCGGG + Intergenic
1082997061 11:59263075-59263097 GGTGGCTCCCAGCCCTGCCAGGG + Intergenic
1083179733 11:60977411-60977433 TGGGGATCCCAGCCCTACCAGGG - Intronic
1083311639 11:61786753-61786775 TTGGGAGCCAAGCCCTCCCAGGG - Exonic
1084428353 11:69097739-69097761 TGGGGATCCTGGTCCTCCCATGG + Intergenic
1084974297 11:72788099-72788121 TGGGGATCCTGGACCTACCCAGG + Intronic
1088756165 11:112887090-112887112 TTGGAATCCCAGCCCTGCCAAGG - Intergenic
1089493504 11:118897524-118897546 TGGGGGTCTCAGCCCTGCTAGGG + Exonic
1202821046 11_KI270721v1_random:69412-69434 TGGGCCTCCCAGCCCTGCAAGGG + Intergenic
1096214769 12:49792906-49792928 TGGGGGTCCCACTGCTACCATGG + Exonic
1096562513 12:52447060-52447082 AGGGCATCCCAGCTCTACCCGGG + Exonic
1097550706 12:61064924-61064946 TGGGGATTCCTGCCCCAGCAGGG + Intergenic
1098328004 12:69322677-69322699 TGGGGCTCTCAGCCTTACCCAGG + Intergenic
1104319555 12:127737704-127737726 TTGGGAGCACAGCCCTACCCAGG + Intergenic
1112024563 13:95400338-95400360 TGGGGAGCCCACCCCTACCCTGG + Intergenic
1113082432 13:106534019-106534041 TAAGGATCCCATTCCTACCAGGG + Intronic
1113436587 13:110296960-110296982 CAGGGCTTCCAGCCCTACCAGGG + Intronic
1114416505 14:22548428-22548450 TGAAGATACCAGCCCTACCAAGG + Intergenic
1117373192 14:55097364-55097386 AGGGGATCCCAGCCCTACAGAGG + Intergenic
1118079200 14:62338865-62338887 TGTGTCTCCCAGCGCTACCATGG + Intergenic
1118837177 14:69485386-69485408 CTGGGATCCCACCCCGACCACGG - Intronic
1121320544 14:92989270-92989292 TTGGGATCCCAGGCCTCCCTGGG - Intronic
1122025171 14:98870575-98870597 TGGGTAGCTCAGGCCTACCAGGG + Intergenic
1125210428 15:37208547-37208569 TAGGGATCCCAGCACTATGATGG - Intergenic
1133002654 16:2858832-2858854 TGGGAGTCCCAGCCCTTCCCGGG - Intergenic
1133155745 16:3874368-3874390 TGGGGAGCACTGGCCTACCACGG - Intronic
1133244833 16:4441330-4441352 TGGGCATCCCAGGTCTACCAAGG - Intronic
1136716293 16:32286424-32286446 GGGGCATCCCTGCCCTCCCAGGG + Intergenic
1136834679 16:33492702-33492724 GGGGCATCCCTGCCCTCCCAGGG + Intergenic
1139128340 16:64109188-64109210 TGGGGATCCAACCCCCACCCAGG + Intergenic
1141168765 16:81678058-81678080 TGGGGATGGCAGCCCAACCCAGG - Intronic
1142047204 16:87933068-87933090 TGGGGAGCCCAGCCCAACCACGG + Intronic
1142362830 16:89635424-89635446 TGGGGGTCCCAGGCCCCCCAAGG + Intronic
1142362885 16:89635647-89635669 TGGGTAGCCCATCCCTTCCAGGG - Intronic
1203010124 16_KI270728v1_random:231330-231352 GGGGCATCCCTGCCCTCCCAGGG - Intergenic
1203144848 16_KI270728v1_random:1792990-1793012 GGGGCATCCCTGCCCTCCCAGGG + Intergenic
1143621944 17:8085899-8085921 AGGGGGGCCCAGCCCCACCAGGG - Intronic
1143731581 17:8885442-8885464 TGGGTAACCCCGCCCTCCCATGG + Intronic
1143731702 17:8885721-8885743 TGGGTAACCCCGCCCTCCCATGG + Intronic
1143731717 17:8885754-8885776 TGGGTAACCCCGCCCTCCCATGG + Intronic
1143731732 17:8885787-8885809 TGGGTAACCCCGCCCTCCCATGG + Intronic
1144768475 17:17745936-17745958 TGGGGAGCCGAGCCATACCATGG + Intronic
1145799654 17:27674699-27674721 TGTGTATCCCAGGCCTACCCTGG - Intergenic
1146321507 17:31850377-31850399 AGTGGATCCCAGACCTGCCAAGG + Intergenic
1146472284 17:33134245-33134267 TGTGAATCCCAGCTCTACCTTGG - Intronic
1147403398 17:40194194-40194216 TGGGGGTCCCAGCCCTGACCAGG - Exonic
1148776240 17:50097040-50097062 TGGGAAACCCATCCCTACCTAGG - Intronic
1149772192 17:59331321-59331343 TGGGAATCCCAGCCCTGCCCTGG + Intergenic
1151657570 17:75502889-75502911 TGGAGATCCCAGCCCCCCCCAGG - Exonic
1152160780 17:78667322-78667344 TGGGGCTCCCTGCCCCACCCAGG + Intergenic
1152701568 17:81822335-81822357 TGGGGTTTCCAGCCCTGCCCGGG + Intergenic
1153712503 18:7814208-7814230 TGGGGATCCCCGTTCTTCCAGGG + Intronic
1155054271 18:22170873-22170895 CTGGTATCCCAGCCCTTCCAGGG + Intronic
1161301245 19:3544130-3544152 TGGGCATCTCAGCCCTGCCCTGG - Intronic
1162821675 19:13226902-13226924 TGGGGATTCGAGACCTTCCAAGG - Intronic
1163258320 19:16171407-16171429 TGGGGACCTCAGACCCACCAAGG - Intronic
1163797891 19:19347859-19347881 TGGGGATCCCAGGGCTAAAAGGG - Intronic
1164459852 19:28437444-28437466 TGGGGAGCCCAGTCTTACCCAGG - Intergenic
1164593657 19:29519832-29519854 TAGTGATCCCAGCCCTGGCAGGG - Intergenic
1164845019 19:31424616-31424638 TTGGCACCCCAGCCCCACCAGGG + Intergenic
1167444272 19:49528223-49528245 GGGGGGTCCCAGACCTGCCAGGG - Intronic
1202653139 1_KI270707v1_random:24610-24632 TGTGGATCCCACACCTGCCAAGG - Intergenic
925237175 2:2289996-2290018 TGGGGATCCCAGCCCTGCTATGG - Intronic
926134900 2:10329727-10329749 CGTGGATCCCAGCCCTGCCCAGG + Intronic
928427854 2:31193381-31193403 TGGGCATCCCAGCCCTCTCATGG + Intronic
931826112 2:66002748-66002770 TGGGTATCCCAGCTCAAGCAGGG + Intergenic
932128804 2:69169040-69169062 TGGGGATTGGAGCCCTAACAAGG + Intronic
935199486 2:100844026-100844048 TGGGCAGCCCGGCCCTATCAGGG - Intronic
936484514 2:112914755-112914777 AGGAGATCCCAGCCCTGACAAGG - Intronic
937976171 2:127583336-127583358 CTGGGATCTCAGCCCTCCCAGGG + Intronic
942525480 2:176848802-176848824 AGAGCTTCCCAGCCCTACCATGG + Intergenic
946412522 2:219522412-219522434 AGGGGTTCCCAGCCCTCCCCGGG - Intronic
948462444 2:238136898-238136920 TGGGGCTCCGAGCCCCACGACGG + Intergenic
948499871 2:238384141-238384163 TGGGGATGACAGCCTGACCAGGG - Intronic
1175040408 20:56044431-56044453 TGGATAACCCTGCCCTACCATGG - Intergenic
1175499600 20:59440550-59440572 TGGGCATTCCACCTCTACCAAGG - Intergenic
1175850332 20:62087232-62087254 TTGGGACCCCAGCCCAGCCAAGG + Intergenic
1175971648 20:62689550-62689572 AGGGGACCCCAGCCCCAGCAGGG + Intergenic
1175999611 20:62826013-62826035 TGGGGGTCCCACCTCTGCCAAGG + Intronic
1176599012 21:8775041-8775063 TGTGGATCCCACACCTGCCAAGG + Intergenic
1176947772 21:15004572-15004594 TGGGGAAACAAGCCCCACCAAGG + Intronic
1180419419 22:12799860-12799882 TGTGGATCCCACACCTGCCAAGG - Intergenic
1181749030 22:24976243-24976265 ATTGGATCCCAGCCCTAACAAGG + Intronic
1184432342 22:44448892-44448914 TGGGGATCACAGTCCTACTTAGG - Intergenic
1184798284 22:46744663-46744685 TTGGGATCCCAGCACAGCCAGGG + Intergenic
1185182566 22:49371825-49371847 TGGGCATCCCAGCGCCCCCAAGG - Intergenic
949331621 3:2929941-2929963 TGGGGATCCCTGCCCTGGCATGG - Intronic
950602759 3:14049364-14049386 TGGGGGTCCCTGTACTACCAGGG + Intronic
952501927 3:33971039-33971061 TGGGGATCCCAGGCATTCCATGG + Intergenic
953933427 3:47018964-47018986 TGTGGCTCCCAGCCCTAATATGG + Intronic
954302185 3:49705891-49705913 TCTGGACCCCAGCCCTGCCAAGG - Intronic
954708103 3:52491809-52491831 TGGTGCTCCCAGCCCCACCAGGG + Intronic
954745908 3:52787465-52787487 TGGGGGTCTCAGCCCTCCCCTGG - Intronic
955786589 3:62547198-62547220 TGTGGATCCCAGCCGTCCCATGG - Intronic
957646574 3:82938970-82938992 TGGGCATCCCAGCGCTCTCAGGG + Intergenic
962390363 3:134966609-134966631 TGGGGAAGCCAGCCCTGCCTGGG - Intronic
969430267 4:7149845-7149867 TGAGAATCCCAGCCCTAACCTGG - Intergenic
969431043 4:7154498-7154520 TAGGGACCCCAGACCCACCACGG - Intergenic
969466724 4:7361692-7361714 TGGGGTCCCCAGCCCTTCCCCGG - Intronic
971404737 4:26312095-26312117 TGAGGACCACAGCTCTACCAGGG + Intronic
971834208 4:31741158-31741180 TGCAGATCCCAGCTCTACCTAGG + Intergenic
972279714 4:37590385-37590407 TGGGAATTCCAGCCCCACCCAGG + Exonic
973362367 4:49177413-49177435 TGTGGATCCCACACCTGCCAAGG + Intergenic
973398732 4:49619448-49619470 TGTGGATCCCACACCTGCCAAGG - Intergenic
973536861 4:51891873-51891895 TGGGGGTCCCTGCCCTTCCCAGG + Intronic
985962551 5:3313648-3313670 TGGAGGTCCCAGGTCTACCATGG + Intergenic
988482141 5:31639556-31639578 CGGGAATCCCAGCCCTGGCAGGG + Intronic
990896071 5:60701094-60701116 TGGGCATCCTCTCCCTACCACGG + Intergenic
991963142 5:72065495-72065517 TGGGGACCCCAGCTCTAAAATGG + Intergenic
997359881 5:133288334-133288356 TGGGGCTCCCTGTCCCACCATGG - Intronic
998896550 5:146806276-146806298 TGTGCATCTCAGGCCTACCAAGG + Intronic
999252800 5:150192576-150192598 TGGAGTTCCCAACCCCACCATGG - Intronic
1001171143 5:169419956-169419978 TGTAGAGCCCAGCCCTTCCATGG - Intergenic
1002062843 5:176636523-176636545 TGGGGATTCCAGCCCCGCCTGGG + Intronic
1003631974 6:7795443-7795465 TGGGGATCCCTGAACTAACAGGG - Intronic
1005850504 6:29817266-29817288 TGACTCTCCCAGCCCTACCAAGG + Intergenic
1006502746 6:34468711-34468733 TGGGGTTCCCAGCCCAAGCTGGG - Intronic
1007214923 6:40229315-40229337 TCTGGATCCCACACCTACCAAGG - Intergenic
1007451474 6:41942794-41942816 TGAGGATCCCTGCCCTACTGGGG + Intronic
1016923278 6:149317253-149317275 AGGGGGTCCCAGCCCTCCCCGGG + Intronic
1019270345 7:143627-143649 AGGGGGTCCCAGCCCTGCCAGGG + Intergenic
1022523577 7:31023111-31023133 TGGAGATCCCAGCCTACCCAAGG - Intergenic
1023731594 7:43197247-43197269 TGGGGGTCACAGTCTTACCATGG + Intronic
1023857739 7:44195000-44195022 TGGGGAGCCCAGCCACACAATGG - Intronic
1028511016 7:91626435-91626457 TGGAGCTCCCAGGCCTATCAAGG - Intergenic
1029142892 7:98424217-98424239 TTGGGTTCCAATCCCTACCATGG - Intergenic
1032006521 7:128306182-128306204 TGGGGACCTCAGCCATCCCAGGG - Exonic
1034192874 7:149224778-149224800 GGGGGATCCCTGCCCCACCCTGG - Exonic
1034823069 7:154234892-154234914 CGGGGATCCCAGGCCTCCCAGGG - Intronic
1035219496 7:157397438-157397460 TGGGGATGCCAACCCCAGCAGGG + Intronic
1037318585 8:17622790-17622812 CAGGGAACCCAGCCCTACCGAGG - Intronic
1037884365 8:22588680-22588702 TGGGGAGCCGAGCCCTCCCTGGG - Intronic
1039887454 8:41663309-41663331 TGAGCATCCCTGGCCTACCATGG - Intronic
1042415526 8:68513793-68513815 ATGTGATCCCAGCCCTAGCAGGG + Intronic
1047514768 8:125544636-125544658 TGGGCAGCCCAGGCCTCCCATGG + Intergenic
1049249574 8:141580976-141580998 TGAGGCTCCCAGCCCCACCGCGG - Intergenic
1057898609 9:98930191-98930213 TGAGGAACCCAGCCCTACCAGGG - Intergenic
1058670442 9:107356819-107356841 TGGGATTCTCAGCCCTAGCACGG + Intergenic
1060618911 9:125044932-125044954 TGGAGATGCCTGCCCCACCACGG + Intronic
1060831331 9:126719527-126719549 TGGGGATCCCAGTAGCACCATGG - Intergenic
1061378533 9:130240503-130240525 TGTGGATCCCTGCCCTACAGTGG + Intergenic
1061950814 9:133934978-133935000 TGGGGACTCCAGGGCTACCAGGG - Intronic
1185787409 X:2902452-2902474 TGGAGATCCCATTCCAACCATGG + Intergenic
1186435983 X:9543509-9543531 GGGGCATCCCAGCCCACCCATGG + Intronic
1189401654 X:40675107-40675129 TGGGCATCTCAGGCCCACCAAGG + Intronic
1190023792 X:46903779-46903801 TGGGAGTCCCAGCGGTACCAGGG + Intergenic
1193762822 X:85488795-85488817 TGGAGAGCCCAACCCAACCAGGG - Intergenic
1198109211 X:133487850-133487872 TGGGGGTCCCAGACATGCCATGG + Intergenic
1198481443 X:137045141-137045163 TGCTGATCCCAGCACAACCAGGG - Intergenic
1198534888 X:137575448-137575470 TCGAGATCCCAGAGCTACCAGGG - Intronic
1200207414 X:154327127-154327149 TGTGGGTCCCAGCCCTGCCCTGG + Intronic