ID: 1083179765

View in Genome Browser
Species Human (GRCh38)
Location 11:60977571-60977593
Sequence GATGACACCTTGGCCAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083179765 Original CRISPR GATGACACCTTGGCCAACAC TGG (reversed) Intronic
900928335 1:5719937-5719959 GATTGCATCTTGGCCAACCCTGG - Intergenic
901819264 1:11816115-11816137 AATGGCACCTTGCTCAACACAGG - Intronic
902131545 1:14265741-14265763 GATGACATCATGGCAAAAACAGG + Intergenic
907965329 1:59323308-59323330 GATGATAAGTTGGCCACCACTGG - Intronic
909284810 1:73802358-73802380 GATGACACCTTAGTAAACATTGG + Intergenic
912163840 1:107019056-107019078 GATGCCACTGTGGCCAACAGGGG + Intergenic
920328734 1:205188556-205188578 GATGGCATCTTGGTCAACAAAGG - Intronic
922387119 1:225097989-225098011 GAGGCCATCTTGGGCAACACAGG + Intronic
1065891571 10:30125757-30125779 GGTGCTTCCTTGGCCAACACAGG - Intergenic
1067547423 10:47203937-47203959 AATGACTCCTTGGCCAATTCCGG - Intergenic
1069000416 10:63257033-63257055 GAGAACATCCTGGCCAACACTGG + Intronic
1069914351 10:71778175-71778197 GATGACACCCTGGGGGACACAGG - Intronic
1070346349 10:75546159-75546181 GTTGGCACCATGCCCAACACTGG - Intronic
1071359415 10:84830889-84830911 GATGGCACCTTGGCCTACTCTGG + Intergenic
1073177456 10:101565153-101565175 GATGAGATCTTGGCCATCAGAGG + Intergenic
1075650955 10:124128194-124128216 GATGACCCCGTGGGCAAGACCGG + Intergenic
1076683374 10:132186459-132186481 GAAGGCACCTTGGCCAAAGCCGG - Intergenic
1076744721 10:132507161-132507183 AAGGTCACCTTGGCTAACACAGG + Intergenic
1077992771 11:7426605-7426627 CATGACCCCTGGGCCAACACAGG - Intronic
1079569450 11:21924165-21924187 GGTGACATCTTGGCAAACAAAGG + Intergenic
1079821562 11:25137586-25137608 AATGACATTTTGGCCAACAATGG - Intergenic
1080429101 11:32182381-32182403 GTTGGCACCTGGGCTAACACTGG - Intergenic
1080864306 11:36179791-36179813 GATGCCAGCCTGGGCAACACAGG + Intronic
1083179765 11:60977571-60977593 GATGACACCTTGGCCAACACTGG - Intronic
1084480378 11:69416364-69416386 GATGACTCCTTGACAAGCACTGG - Intergenic
1085537604 11:77232940-77232962 GATGGCACAGTGGGCAACACAGG + Intronic
1086018957 11:82202530-82202552 AATGACATTTTGGCCAACATTGG - Intergenic
1086527199 11:87741526-87741548 AATGACACCTAATCCAACACAGG - Intergenic
1090361211 11:126174074-126174096 GCTAAGACCTTGGCCTACACAGG + Intergenic
1092052512 12:5482251-5482273 CCTGGCACCCTGGCCAACACAGG - Intronic
1094657360 12:32433194-32433216 GATTCCAGCTTGGCCAACATGGG - Intronic
1096324406 12:50646619-50646641 GAGGCCAGCCTGGCCAACACAGG - Intronic
1097986571 12:65788706-65788728 GAAGACACTTTGGGAAACACTGG - Intergenic
1101040706 12:100752717-100752739 GATCACATCTTTGCCAACTCTGG - Intronic
1101294386 12:103406007-103406029 GATGAGATCTTGGCCAAAATCGG - Intronic
1104536690 12:129624435-129624457 GATGACTCATTGGCCCTCACTGG - Intronic
1105528040 13:21193895-21193917 GAGAACAGCCTGGCCAACACAGG + Intergenic
1106564016 13:30870269-30870291 CATAACTCCTTGGCCTACACGGG + Intergenic
1107121588 13:36802104-36802126 GTTGACCCCTTGAACAACACAGG + Intergenic
1107698674 13:43024855-43024877 GAGGACAGCCTGGGCAACACAGG + Intronic
1112241263 13:97683859-97683881 CAAGACACCGTGGCCAATACGGG - Intergenic
1117582161 14:57162410-57162432 ACTGACCCCTTGGCAAACACAGG + Intergenic
1118261141 14:64247992-64248014 GAGACCAGCTTGGCCAACACAGG + Intronic
1123426448 15:20174780-20174802 GAGAACATCTTGGCCAACATAGG - Intergenic
1123918581 15:25054972-25054994 GATGACAAGTTGGCCAGCAGAGG + Intergenic
1126429141 15:48562064-48562086 GATCACATTTTGGGCAACACTGG + Intronic
1129132978 15:73517431-73517453 GATGACAGCTTGGACTACAATGG + Intronic
1129909734 15:79216468-79216490 GCTGCCATATTGGCCAACACAGG + Intergenic
1131311287 15:91292636-91292658 GAGGACACCTTGGATAGCACGGG + Exonic
1131566114 15:93487013-93487035 CATGCCACCTTTCCCAACACAGG + Intergenic
1132748206 16:1445665-1445687 GAGGACACCTGGCCCAGCACAGG - Exonic
1136012757 16:27374824-27374846 GATGAGAGTTTGGGCAACACTGG + Intergenic
1136188696 16:28602607-28602629 GGTGACAGCACGGCCAACACAGG + Intergenic
1136191166 16:28615601-28615623 GGTGACAGCACGGCCAACACAGG + Intronic
1137043663 16:35637528-35637550 GTGGACACCTGGGCCAACTCTGG - Intergenic
1137048746 16:35690872-35690894 AAAGACAACTTGGCCACCACAGG - Intergenic
1137052672 16:35726941-35726963 AAAGACACCTTGGCCACCCCAGG - Intergenic
1139221303 16:65185255-65185277 GATGAAACCCTGGGCAACCCAGG + Intergenic
1141192757 16:81836315-81836337 GCTGACACGTGGGCCAATACAGG - Intronic
1141456806 16:84147864-84147886 GAGGACAGCCTGGCCAACATGGG + Intronic
1142527009 17:550178-550200 GATGTCACGTTGGCCCAGACAGG + Intronic
1142735072 17:1892291-1892313 CACCACACCTTGCCCAACACTGG + Intronic
1142992242 17:3739170-3739192 GGTGACACTTTGGCACACACTGG - Intronic
1143083258 17:4396992-4397014 GATGGCATGTTCGCCAACACTGG - Intergenic
1146391133 17:32424100-32424122 GAGGCCAGCTTGGGCAACACTGG + Intergenic
1146604648 17:34247761-34247783 GATGACACTGTGGCCAAGGCTGG - Intergenic
1146682033 17:34815366-34815388 GATGAGGCCTTGGCTGACACCGG - Intergenic
1149707164 17:58705531-58705553 GAGAACATCTTGGCCAACATGGG - Intronic
1150625588 17:66839159-66839181 GAGAACATCTTGGCCAACATGGG - Intronic
1152121100 17:78419208-78419230 GAGGCCACCCTGGGCAACACAGG - Intronic
1152280770 17:79383835-79383857 GAGGCCTCCCTGGCCAACACTGG + Intronic
1154472597 18:14719624-14719646 GAGGCCATCTTGGCCAACATGGG - Intergenic
1155357934 18:24971558-24971580 GTTAACACCATGGCAAACACTGG + Intergenic
1163475890 19:17525898-17525920 GAGGCCAGCCTGGCCAACACAGG + Intronic
1164385613 19:27768614-27768636 CAAGACACCTTGGCGATCACAGG - Intergenic
1164565124 19:29320429-29320451 GCTGACACCTGGGCCGAGACGGG - Intergenic
1164722924 19:30445207-30445229 GAAGACACTTTGGCAAACGCCGG + Exonic
1166871487 19:45873568-45873590 GGTGACGACATGGCCAACACGGG - Exonic
1167540599 19:50084855-50084877 GAAGGCAGCCTGGCCAACACGGG + Intergenic
1167629117 19:50612960-50612982 GAAGGCAGCCTGGCCAACACGGG - Intergenic
1168490133 19:56802239-56802261 GTTGACTTCTTGGTCAACACAGG + Intronic
1168627797 19:57932839-57932861 GATGACACTTGGGCCAAGGCTGG - Intronic
927971470 2:27308225-27308247 GAAGACGCCTTGGGGAACACAGG + Exonic
930879170 2:56252245-56252267 GATACCAGCCTGGCCAACACAGG - Intronic
934136167 2:88998167-88998189 GATGCCAGCCTGGGCAACACAGG + Intergenic
934882907 2:97998636-97998658 GATGACACCTTGAGAACCACTGG - Intergenic
934962351 2:98687793-98687815 GCTGACACCATTTCCAACACCGG + Intronic
935347586 2:102122952-102122974 AAAGACACCTTGGCCATGACTGG - Intronic
939923560 2:148146434-148146456 GAGATCACCTTGGACAACACAGG - Intronic
942357307 2:175131233-175131255 GATGACACTTGGGGAAACACTGG + Intronic
943254966 2:185583316-185583338 GATACTACCTTGGCCACCACAGG - Intergenic
948893756 2:240918946-240918968 GCCGTCACCTTGGCCAGCACCGG - Intronic
1169149169 20:3275761-3275783 GGTGAGACCTTGGCCAAATCTGG - Intronic
1170569451 20:17624764-17624786 GATGCCACCCTGGCCCACAGAGG + Intronic
1172655355 20:36533529-36533551 GAAGCCCCCGTGGCCAACACAGG + Intergenic
1172731195 20:37089723-37089745 CATAACATCTTGGTCAACACTGG + Intronic
1172962314 20:38807388-38807410 GAACACTCCTTGGCCAATACTGG + Intronic
1180614122 22:17116883-17116905 GATGGCAACTTGGCCAATTCTGG - Exonic
1181309574 22:21937367-21937389 GCTGCCGCCATGGCCAACACAGG + Intronic
1182752636 22:32654076-32654098 GGAGACACCTTGGGCACCACAGG - Intronic
1183177849 22:36237610-36237632 CAAGACAGCTTGGGCAACACAGG - Intronic
953062699 3:39440488-39440510 GAGGCCAGCTTGGGCAACACAGG + Intergenic
954214074 3:49114755-49114777 CATCACACCTTGGCACACACAGG + Exonic
959060047 3:101608377-101608399 AATGACATGTTGGCCAACAACGG + Intergenic
960688989 3:120323729-120323751 GATGACTGCTTGGCAAAGACAGG - Intergenic
962270340 3:133973662-133973684 CAGTACACCTTGGCCAGCACTGG - Exonic
965831384 3:172793362-172793384 GAGGCCAACTTGGCCAACATGGG - Intronic
965959117 3:174407686-174407708 GATGACACTTTGGTGAATACCGG - Intergenic
967452818 3:189646077-189646099 GATCACACCTTGGGAACCACTGG - Intronic
968738924 4:2317352-2317374 GATGACACCTTTTCCACCAGAGG + Intronic
968929918 4:3573384-3573406 CATGAGACCTTGACGAACACGGG - Intergenic
970119867 4:12741615-12741637 GAGACCACCCTGGCCAACACTGG - Intergenic
977459451 4:97307271-97307293 GATGAGACCTGGGCCAAAACTGG + Intronic
977957494 4:103047086-103047108 GATGACATTCTGGCCATCACTGG - Exonic
982277332 4:153649991-153650013 GATGACACTTTGGCCAACAATGG - Intergenic
984183506 4:176513606-176513628 GATACCAGCCTGGCCAACACGGG + Intergenic
984765023 4:183393935-183393957 CATCAGACCTTTGCCAACACTGG + Intergenic
985029307 4:185772884-185772906 CATGAAACCTTTGGCAACACAGG + Intronic
987018960 5:13850029-13850051 GATGTCTCCTTGGCCCACTCTGG - Intronic
988846225 5:35130862-35130884 GAGGACACCTTGGAAAACAGCGG + Intronic
993238462 5:85346790-85346812 GAGGACACCATGGGCCACACAGG - Intergenic
993709436 5:91209926-91209948 CATGACATCTTGGTCAACAATGG - Intergenic
995795132 5:115933093-115933115 GGTGACTCCTTGGCCATCAGTGG - Intergenic
998393926 5:141806180-141806202 GATGACACCTGGGCCCAGACTGG + Intergenic
999883825 5:155897831-155897853 GATGACATGTTGGTCAACAATGG - Intronic
1000564803 5:162834482-162834504 GAGGAGAAATTGGCCAACACAGG + Intergenic
1000901930 5:166921616-166921638 GAGAACATCCTGGCCAACACGGG - Intergenic
1003528315 6:6916863-6916885 GCTCACACATTGGCCCACACTGG - Intergenic
1004207669 6:13607260-13607282 CAAGAAACCTTGGCAAACACTGG + Intronic
1007116733 6:39348346-39348368 GATCACACCGTGGCCAATAGGGG + Intronic
1008485833 6:52034530-52034552 TTTGACACTTTGGCCAATACTGG - Intronic
1016699142 6:147034136-147034158 TAGGACACCTGGCCCAACACTGG + Intergenic
1016851637 6:148625123-148625145 GAGGCCAGCCTGGCCAACACTGG - Intergenic
1017270313 6:152496031-152496053 GAAGAGACCTTGTGCAACACTGG - Intronic
1018038559 6:159902326-159902348 GCTGCCATGTTGGCCAACACAGG - Intergenic
1019460717 7:1156962-1156984 GGTCAGACCCTGGCCAACACTGG + Intronic
1019593284 7:1846417-1846439 GATGACACCACAGCCACCACAGG + Intronic
1024511867 7:50211008-50211030 GAAGACAGCGTGGCCAAGACGGG + Intergenic
1025129495 7:56368132-56368154 GCTGACCCCTTGGCTCACACCGG - Intergenic
1026672030 7:72399113-72399135 GCTGACACCTTAGCAAAGACAGG + Intronic
1026672313 7:72401064-72401086 GTTGACACCTTAGCAAAAACGGG - Intronic
1027267431 7:76502084-76502106 GAGGCCAGCCTGGCCAACACGGG - Intronic
1027319244 7:77001948-77001970 GAGGCCAGCCTGGCCAACACGGG - Intergenic
1029127143 7:98302303-98302325 ACTGACACTTTGGCCAACCCTGG - Intronic
1029687950 7:102161972-102161994 GATGACTCCATGGCCAGGACAGG + Intronic
1029960197 7:104682293-104682315 GATGACACCTTGAGGAACAAGGG - Intronic
1030454390 7:109754782-109754804 TATGACAGCCTGGCCAACATGGG - Intergenic
1031279464 7:119778958-119778980 GAGACCGCCTTGGCCAACACAGG - Intergenic
1033533093 7:142285853-142285875 GGTGAAACCTTGGAAAACACAGG + Intergenic
1035413677 7:158666725-158666747 GACGCCACCCTGGGCAACACAGG + Intronic
1035625542 8:1067972-1067994 CATGAACCCTTGGCAAACACAGG + Intergenic
1037474105 8:19239276-19239298 CATGACACTTTGGAAAACACAGG - Intergenic
1038347026 8:26742075-26742097 GATGACACCATGGCCAGTTCTGG + Intergenic
1042313223 8:67399068-67399090 GAGAACAGCCTGGCCAACACAGG - Intergenic
1045526904 8:102948742-102948764 GAAGACACTTTGGCCCAGACAGG + Intronic
1048474313 8:134729608-134729630 CCTGACAGCTTGGCCAACTCTGG - Intergenic
1048797133 8:138160974-138160996 GATGAGACCTTGGACAACTATGG + Intronic
1049251429 8:141591163-141591185 GAGCACACTTTGCCCAACACTGG + Intergenic
1051430362 9:16975697-16975719 GCTCACACCTTTGCCAACAGTGG - Intergenic
1053455085 9:38227404-38227426 GATGAAACCCTGGCCCCCACGGG + Intergenic
1054460360 9:65459087-65459109 CATGAGACCTTGACGAACACGGG + Intergenic
1056118467 9:83463823-83463845 GATGACACACTGGCCATCAATGG - Intronic
1059301271 9:113315432-113315454 GGTGACACCATCACCAACACTGG - Exonic
1061219661 9:129242867-129242889 AAAGGCACCTTGGCCAAAACTGG - Intergenic
1061895374 9:133644196-133644218 TCTGACACCTTGCCCCACACAGG + Exonic
1185662529 X:1738681-1738703 GAGAACCCCTTGGCCAACAGGGG + Intergenic
1188523459 X:31063398-31063420 ACTGACACTTTGGCCAACAAGGG + Intergenic
1189095543 X:38134790-38134812 CATGCAACCTTGGACAACACAGG + Intronic
1190661960 X:52662775-52662797 GAGAACAGCCTGGCCAACACGGG + Intronic
1194684419 X:96895202-96895224 GAGAACAGCCTGGCCAACACGGG - Intronic
1195116684 X:101706387-101706409 CAAGACAGCCTGGCCAACACAGG - Intergenic
1199499310 X:148492604-148492626 GCAGACACTTTGGCCAAAACTGG + Intergenic