ID: 1083180304

View in Genome Browser
Species Human (GRCh38)
Location 11:60980995-60981017
Sequence AGCCTGGACCTCAGCTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 5, 3: 29, 4: 284}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083180304_1083180306 3 Left 1083180304 11:60980995-60981017 CCAAAGGAGCTGAGGTCCAGGCT 0: 1
1: 0
2: 5
3: 29
4: 284
Right 1083180306 11:60981021-60981043 TTCTGCCTCCTGACCCAGACTGG 0: 1
1: 1
2: 11
3: 52
4: 344
1083180304_1083180309 15 Left 1083180304 11:60980995-60981017 CCAAAGGAGCTGAGGTCCAGGCT 0: 1
1: 0
2: 5
3: 29
4: 284
Right 1083180309 11:60981033-60981055 ACCCAGACTGGTGTGCCATGAGG 0: 1
1: 1
2: 11
3: 278
4: 1796

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083180304 Original CRISPR AGCCTGGACCTCAGCTCCTT TGG (reversed) Intronic