ID: 1083180615

View in Genome Browser
Species Human (GRCh38)
Location 11:60982473-60982495
Sequence GGGTGTTCACCTCTTTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083180615 Original CRISPR GGGTGTTCACCTCTTTCAGG AGG Intronic
901222149 1:7589285-7589307 GGGTGTTGCCCTCTTCCTGGGGG + Intronic
903650076 1:24916810-24916832 GGGAGGTCACCTGTCTCAGGTGG + Intronic
904755794 1:32767899-32767921 GAGTGTGCAGCTCTTCCAGGTGG - Exonic
909286834 1:73830235-73830257 GGGTGCTCACATCTTACAGATGG + Intergenic
911336080 1:96582024-96582046 AGGTGCTCTGCTCTTTCAGGAGG - Intergenic
916640662 1:166725498-166725520 TGGAGATCACATCTTTCAGGGGG + Intergenic
920301029 1:204989149-204989171 GAGTGTTCACCTCTTGAGGGAGG + Intronic
922865005 1:228852305-228852327 GGAAGTTCACGTCTTTGAGGGGG + Intergenic
923034307 1:230273492-230273514 GGGTGTTCATCCCTTTGAGTGGG + Intronic
1065484908 10:26228111-26228133 GGGTGTTCCCCTTGGTCAGGAGG + Intronic
1067336636 10:45371752-45371774 GGGTGTTCACCTCTTGAACCAGG + Intergenic
1072102040 10:92238910-92238932 GGGTGTGGACCGCTTGCAGGCGG + Intronic
1072104594 10:92261819-92261841 GGATTTTCACATCTTTAAGGTGG - Intronic
1072213998 10:93272831-93272853 GGGTCTGCACCTCCTCCAGGAGG + Intergenic
1074583196 10:114740909-114740931 TGGTGTGCACCACTCTCAGGAGG + Intergenic
1075424684 10:122332459-122332481 GGGTGTTAAGATCTTTCAGGTGG - Exonic
1081944464 11:46977413-46977435 GGTTTTTCACATTTTTCAGGCGG - Intronic
1082778531 11:57267801-57267823 TGGGGATCACATCTTTCAGGTGG + Intergenic
1083180615 11:60982473-60982495 GGGTGTTCACCTCTTTCAGGAGG + Intronic
1089282499 11:117384327-117384349 GGGTGGTCATGTCTTTCAGATGG + Intronic
1092494756 12:8982057-8982079 GGGTGTTAACATATTTGAGGTGG - Intronic
1094372148 12:29750265-29750287 GGCAATTCACCTCATTCAGGAGG + Intronic
1103026663 12:117579726-117579748 GGGGTCTCAGCTCTTTCAGGAGG - Intronic
1103985308 12:124763186-124763208 GGCTATCCACCTCTTTCTGGAGG - Intergenic
1104979463 12:132567328-132567350 GCGTGTTCACCTCGTACACGGGG + Intronic
1105273400 13:18899708-18899730 ATGTGTCCACCTCTTGCAGGGGG + Intergenic
1112433805 13:99376132-99376154 GGGTGTTTTCCTCATTCAGTGGG + Intronic
1119456705 14:74762365-74762387 AGATCTTCACCTCTCTCAGGAGG - Intergenic
1120812851 14:88822489-88822511 GTGTGTTAACTTCTTTCAGAAGG - Intergenic
1123122580 14:105924705-105924727 GGGTGTGCACATCTTCCATGAGG + Intronic
1124374416 15:29121287-29121309 GGGTGTTCTCCTCATGCAGCCGG - Exonic
1128632797 15:69282598-69282620 GGGGCTTCACCACTTTCAGGAGG + Intergenic
1131408243 15:92184193-92184215 GGGTGCTCAGGCCTTTCAGGAGG - Intergenic
1133150369 16:3824011-3824033 GTGTGTTAAAGTCTTTCAGGAGG + Intronic
1138214223 16:55189001-55189023 GAGTGCTAGCCTCTTTCAGGAGG + Intergenic
1138320474 16:56106847-56106869 GCATTTTCACCTCTTTCTGGAGG - Intergenic
1138555233 16:57766994-57767016 GGGTGCACACCACTGTCAGGGGG + Intronic
1139141144 16:64264094-64264116 GAGTGTACACCTCTTAAAGGTGG + Intergenic
1139928973 16:70510018-70510040 GGGTTTTCTCCTTTTTTAGGTGG - Exonic
1142382298 16:89739730-89739752 GGGGGTCGACCTCTTGCAGGAGG + Intronic
1143761881 17:9110663-9110685 GTGTTTTCTCCTATTTCAGGAGG + Intronic
1144058863 17:11563529-11563551 GGGTCTTCTCCTCCCTCAGGAGG - Exonic
1146458648 17:33026190-33026212 GGCTGTTCACCTCGTTGAGCAGG + Intronic
1148484622 17:47982651-47982673 GCCTGGTCACCTCTTTCTGGGGG + Intergenic
1154465159 18:14637273-14637295 ATGTGTCCACCTCTTGCAGGAGG + Intergenic
1155502795 18:26503950-26503972 GGATGTTCTCCTCTTTCTGCAGG + Intronic
939349510 2:141016689-141016711 GGGTTTTAACCTCATTCATGAGG - Intronic
939959070 2:148550199-148550221 GGGTGTACAGACCTTTCAGGAGG + Intergenic
940565569 2:155356337-155356359 TGCTGTCCACTTCTTTCAGGAGG + Intergenic
944411919 2:199454757-199454779 ATGTGTTCAACTCTTTAAGGAGG + Intronic
944480758 2:200154878-200154900 GGGCATTCATCCCTTTCAGGAGG - Intergenic
948591471 2:239053450-239053472 AGGTGCTCACCTCTTTTCGGCGG + Exonic
1175294706 20:57900326-57900348 GTGTGTCCCCCTCTTTCAGTCGG + Intergenic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1175461054 20:59152313-59152335 GGGAGATCACCACTTACAGGGGG + Intergenic
1176809379 21:13521113-13521135 ATGTGTCCACCTCTTGCAGGAGG - Intergenic
1177262112 21:18743481-18743503 GGGTGTTCACCTCTGGCTGGGGG + Intergenic
1179136328 21:38683134-38683156 GGGTGTTCACCTTTCAGAGGAGG + Intergenic
1179842968 21:44089253-44089275 GGGTATTCACCTCTTCCCTGTGG + Intronic
1180044931 21:45300984-45301006 GCGTCTTCACCTCCTGCAGGCGG - Intergenic
1184074859 22:42169773-42169795 TGGTCTTCAGGTCTTTCAGGAGG + Intronic
949313901 3:2730396-2730418 GGATGCTCACCTGTTTCAGCCGG + Intronic
952323851 3:32302694-32302716 GGTTTTTCACCTATTTGAGGAGG + Intronic
956782949 3:72618824-72618846 GGGGGTGCTCCTCTTTCAGTTGG - Intergenic
963337043 3:143987102-143987124 GGGTGTTCACTTCCTGTAGGAGG - Intronic
968456632 4:703849-703871 GGGTCTGCACCTCCTTGAGGAGG + Intergenic
970210657 4:13706549-13706571 GGATTTTCACCTCTTTTAGGGGG + Intergenic
970328527 4:14954621-14954643 GTGTTTTCAGCTCTTTCATGTGG + Intergenic
972247957 4:37265881-37265903 GGCTGTGCACATCTTTCAGGGGG + Intronic
979531735 4:121775521-121775543 GGGTGTTTACATCATCCAGGTGG + Intergenic
980994696 4:139769226-139769248 GGGTGTTCTTCTCCTACAGGAGG + Intronic
983616097 4:169706849-169706871 GGGTGCTTACTTTTTTCAGGTGG + Exonic
983744117 4:171173381-171173403 GGGTTTTCAGCTCTTTCTGTTGG + Intergenic
986704910 5:10446820-10446842 AGGTTTTCACCTATTTCATGGGG - Intronic
995054221 5:107741614-107741636 GGGTCTTAATCTCTTTCATGAGG + Intergenic
997429967 5:133830745-133830767 GGGTGTTCACCTAATTGACGAGG - Intergenic
1001278296 5:170366771-170366793 GGGTGGCCACCACTTCCAGGAGG - Intronic
1003177404 6:3762227-3762249 GGGGAGTGACCTCTTTCAGGTGG - Intergenic
1003367052 6:5484870-5484892 AGCTGTTCACCTCTCTGAGGGGG + Intronic
1003687515 6:8319036-8319058 GGGTGTTAAGCTCTTTGAGGTGG + Intergenic
1008073962 6:47126748-47126770 CGGTGTTCCCCACTCTCAGGTGG + Intergenic
1008291093 6:49716882-49716904 TGGAGATCACATCTTTCAGGGGG + Intergenic
1011346291 6:86372588-86372610 GGGTGTTAATCTCATTCATGAGG + Intergenic
1014897917 6:126926501-126926523 CGATGTTCTCCTCATTCAGGTGG - Intergenic
1017374303 6:153750320-153750342 GGTTGTTAATCTCTTTCAGTCGG + Intergenic
1019900283 7:4015169-4015191 TGGTTTCCACCTCTTTAAGGTGG - Intronic
1020847789 7:13309260-13309282 AGGTATTCAGCTCTTTCCGGTGG - Intergenic
1020924044 7:14301809-14301831 GGGTTTTCACTCATTTCAGGAGG + Intronic
1022777036 7:33537497-33537519 TGGTGTTCACATCTTTCTGCTGG + Intronic
1023673679 7:42606806-42606828 GGGTATTCACTACTATCAGGAGG + Intergenic
1028527683 7:91803455-91803477 AGGTGTTGACATCTTTGAGGGGG + Intronic
1029794585 7:102880809-102880831 GGGTTTGTACCTCTTTAAGGGGG - Intronic
1031336054 7:120534104-120534126 GAGACTTCACCTCTTTGAGGTGG - Intronic
1033849877 7:145482306-145482328 GGGGGATCACATCTCTCAGGGGG - Intergenic
1034849355 7:154479611-154479633 GAGTGTGCACCTCTTTGAGAGGG - Intronic
1034960370 7:155360918-155360940 GGGTGTTCACCTCTGACACATGG + Exonic
1039315512 8:36367488-36367510 TGGTGTTCTTATCTTTCAGGAGG + Intergenic
1040614884 8:49025148-49025170 GAGTGTTCAGCTCTTAAAGGTGG - Intergenic
1041117190 8:54551343-54551365 GGGATCTCACCTCCTTCAGGTGG - Intergenic
1044816011 8:96113751-96113773 GTCTGTTCTCATCTTTCAGGTGG - Intergenic
1047177700 8:122557172-122557194 TGCTGCTCTCCTCTTTCAGGCGG - Intergenic
1048006306 8:130422091-130422113 GAGTATTCCCCTCTTCCAGGAGG - Intronic
1050018437 9:1260018-1260040 GGGTGTTCTCTTTTTTTAGGTGG - Intergenic
1056048568 9:82744793-82744815 GGGTGATCAGCTGTTTCAGAAGG - Intergenic
1060695537 9:125706571-125706593 GGCTGTTAACCTCTTTAAGGGGG + Intronic
1061615472 9:131776099-131776121 GGGTGTTCTCATCTCTCAGGAGG - Intergenic
1186527771 X:10265201-10265223 GGCTGCTCACTTCATTCAGGTGG - Intergenic
1187706643 X:22015721-22015743 GGCTGATCATCTCTTTCACGTGG - Intergenic
1196886389 X:120250602-120250624 GTGTGTTCGGCTCTTTCCGGAGG - Intergenic