ID: 1083182037

View in Genome Browser
Species Human (GRCh38)
Location 11:60993075-60993097
Sequence GCTGGAAAGAAGGCACGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083182031_1083182037 0 Left 1083182031 11:60993052-60993074 CCTTCTCATTTTACCACCTGGTA 0: 1
1: 0
2: 1
3: 17
4: 218
Right 1083182037 11:60993075-60993097 GCTGGAAAGAAGGCACGGTCTGG 0: 1
1: 0
2: 0
3: 15
4: 170
1083182027_1083182037 12 Left 1083182027 11:60993040-60993062 CCCTCCATGGGACCTTCTCATTT 0: 1
1: 0
2: 0
3: 11
4: 201
Right 1083182037 11:60993075-60993097 GCTGGAAAGAAGGCACGGTCTGG 0: 1
1: 0
2: 0
3: 15
4: 170
1083182029_1083182037 8 Left 1083182029 11:60993044-60993066 CCATGGGACCTTCTCATTTTACC 0: 1
1: 0
2: 2
3: 14
4: 167
Right 1083182037 11:60993075-60993097 GCTGGAAAGAAGGCACGGTCTGG 0: 1
1: 0
2: 0
3: 15
4: 170
1083182028_1083182037 11 Left 1083182028 11:60993041-60993063 CCTCCATGGGACCTTCTCATTTT 0: 1
1: 0
2: 0
3: 23
4: 176
Right 1083182037 11:60993075-60993097 GCTGGAAAGAAGGCACGGTCTGG 0: 1
1: 0
2: 0
3: 15
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083182037 Original CRISPR GCTGGAAAGAAGGCACGGTC TGG Intronic
902070669 1:13733229-13733251 GCTGCAAAGAAAGCACTGTTAGG + Intronic
902528133 1:17072689-17072711 GATGGACAGAAGGCATGGTCAGG - Intronic
902551644 1:17223088-17223110 GCTGGACTGCAGGCAGGGTCCGG + Intronic
902974807 1:20080991-20081013 GCTGGAAAGAACGCACAGTGCGG - Intronic
903425500 1:23251160-23251182 GATATAAAGAAGGCACGATCAGG - Intergenic
905232562 1:36523348-36523370 GCTATGAAGAAGCCACGGTCAGG - Intergenic
905462170 1:38129091-38129113 GCAGGAAAGAAGGAGAGGTCAGG - Intergenic
908094527 1:60722539-60722561 GCTGTACAGAAGGCATGGTTAGG - Intergenic
911049195 1:93655129-93655151 GCTGGAGAGGAGGCAGGGCCAGG + Intronic
911090647 1:94014386-94014408 GAAGGAAAGGAGGCAGGGTCGGG + Intronic
912951150 1:114121345-114121367 GCTGGAAAGAAGGGAAGATGTGG - Intronic
913011329 1:114686777-114686799 TCTGAAAATCAGGCACGGTCTGG + Exonic
913215259 1:116614776-116614798 ACTGGAAGGAAGCCACAGTCTGG + Intronic
914374336 1:147060426-147060448 GCTGAAAAGAGGGCCCGGTGTGG - Intergenic
914476543 1:148028003-148028025 GCTGAAAAGAAGGCTGGGTGTGG + Intergenic
914703717 1:150154847-150154869 GGTGGACAGACTGCACGGTCTGG + Intronic
918392151 1:184077106-184077128 GCTAGAAAGAAGCCAATGTCTGG + Intergenic
919323791 1:196080084-196080106 GCTGGAAAGGAGGGAGGGACTGG - Intergenic
921968198 1:221116133-221116155 GTTGGAATGAAGGCACTGTAGGG + Intergenic
923730286 1:236543538-236543560 TCTGAAAAGAAGCCACAGTCAGG - Exonic
1067552098 10:47243482-47243504 GCTTGAAAGGAGGCAGGGCCTGG - Intergenic
1067771771 10:49131723-49131745 GCTGGAGAGAAGGCGGGCTCAGG - Exonic
1069624599 10:69860058-69860080 GCTGGACGGAAGGCAGAGTCAGG + Intronic
1075121150 10:119665984-119666006 GCTGGAAAGCAGAGACGGTCAGG - Intronic
1075164569 10:120055466-120055488 GCTGGAAAGCAGACATGGTAGGG - Intergenic
1076095839 10:127734944-127734966 GCTAGAAAGCAGGGACGGCCAGG + Intergenic
1076308290 10:129481072-129481094 TCTAGGAGGAAGGCACGGTCAGG - Intronic
1077027684 11:448504-448526 GCTGGAAAGATGGCATGGACGGG + Intronic
1078028873 11:7728205-7728227 CCTGGAAAGAGGTCAAGGTCAGG - Intergenic
1083182037 11:60993075-60993097 GCTGGAAAGAAGGCACGGTCTGG + Intronic
1083598830 11:63933666-63933688 GCTGGAAACCAGGCAAGGCCTGG - Intergenic
1083973771 11:66100376-66100398 GGTAGACAGAAGGCAAGGTCAGG - Intronic
1084954415 11:72683867-72683889 GCTGGAATCAAAGCAGGGTCTGG - Intergenic
1088680881 11:112240549-112240571 GCTGGGAAGCAGGCAGGGACTGG - Intronic
1091723832 12:2832321-2832343 GCAGGGAAGGAGGCACGGCCCGG - Intronic
1095473837 12:42565310-42565332 GCTGGAAGGAAGGAAGGATCTGG + Intronic
1097201464 12:57282328-57282350 GTTGGAAAGAAGGAAAGATCTGG + Intronic
1100517828 12:95345048-95345070 ATTGGAAAGAAGGGACAGTCAGG + Intergenic
1100535509 12:95505249-95505271 TCTATATAGAAGGCACGGTCAGG - Intronic
1101532668 12:105588229-105588251 GCTGGAGAGGAGGCAGGTTCAGG + Intergenic
1104166032 12:126230402-126230424 GCAGGTAAGGAGGCATGGTCAGG + Intergenic
1104842001 12:131829902-131829924 GCTGGAAGGAAGCCACTGTGGGG - Intronic
1105218992 13:18308265-18308287 ACTGGAAGGAAGCCACAGTCTGG + Intergenic
1108583036 13:51843667-51843689 ACTGGAGAGAAGGCACTGCCCGG - Intergenic
1109282043 13:60367878-60367900 GCTGTACAGGAGGCACGGTTGGG - Intergenic
1109772627 13:66997230-66997252 GCTGGACAGGAAGCATGGTCTGG + Intronic
1111575757 13:90152476-90152498 GCTGGAAAGAAGGCAATGCCTGG - Intergenic
1111883195 13:93985108-93985130 GCTGGAAAGATGTGATGGTCAGG - Intronic
1112684861 13:101813213-101813235 GTTGGAGAGAAGGCATGGCCTGG - Intronic
1113965681 13:114152179-114152201 GCTGCACACCAGGCACGGTCAGG + Intergenic
1116150592 14:41136670-41136692 GCTGGAAAGAAGTCAATGTCTGG - Intergenic
1121868309 14:97383581-97383603 GCTGCAAAGACGGTGCGGTCAGG + Intergenic
1122344907 14:101052393-101052415 GCTGGAAGGAAGGCAGACTCTGG + Intergenic
1128329238 15:66745054-66745076 GCTGGAAAGCAGCCACCCTCTGG - Intronic
1130437325 15:83914140-83914162 GCTGGCTGGAAGGCACAGTCAGG - Intronic
1133728595 16:8559331-8559353 GGTGGAATTAAGGCAGGGTCCGG - Intergenic
1134477109 16:14583898-14583920 GCTGAAAAGGAGGCAGGGTGGGG + Intronic
1135128770 16:19834514-19834536 GCTGGACAGCAGGCAGTGTCTGG + Intronic
1136372695 16:29846136-29846158 GCTGGGGAGAAGGCAGAGTCAGG - Exonic
1138454650 16:57114312-57114334 CCTGGAAGGAAGGCAGGGTGAGG + Intronic
1138805185 16:60082663-60082685 GCTGGATTGAAGTCCCGGTCAGG - Intergenic
1141733839 16:85839610-85839632 TGGGGAAAGAAGACACGGTCAGG + Intergenic
1142700671 17:1658425-1658447 GCTGGGAAGAAGGCAGGATGGGG - Intronic
1143105248 17:4526650-4526672 ACTGGAAAGAAAGCAGGGACTGG + Intronic
1144887072 17:18470574-18470596 GCTGGAAAGAAGGCATCACCGGG - Intergenic
1145145144 17:20473721-20473743 GCTGGAAAGAAGGCATCACCGGG + Intergenic
1146096937 17:29939459-29939481 GCTGGAGAGAAGTCAACGTCTGG - Intronic
1146353793 17:32117649-32117671 GCTGGAAAGAAGGCATTACCGGG - Intergenic
1146574687 17:33980723-33980745 CCTGTAAAGAAGGCATGATCTGG - Intronic
1147244572 17:39111583-39111605 GCTGATAAGAAGGCAGGGTTTGG - Intronic
1148877308 17:50697494-50697516 GTTGGAAAGAAGGCATGGGCAGG + Intronic
1149066697 17:52489149-52489171 GCTGGAGAGAACACAAGGTCAGG - Intergenic
1151252025 17:72843522-72843544 GGTGGAAAGAGGGCACTCTCTGG - Intronic
1152272421 17:79332425-79332447 GCTGGAGAGGAGGCAGGCTCTGG + Intronic
1152780460 17:82225542-82225564 GCTGTAAGGCAGGCAGGGTCAGG + Intergenic
1156952340 18:42917717-42917739 GCTGGTGAGGAGGCAGGGTCAGG - Intronic
1157580629 18:48771927-48771949 GCTGGAAAGCTGGCACCGCCTGG + Intronic
1160890489 19:1375890-1375912 GCTTGAACCAAGGCACGGTGGGG - Intronic
1161607154 19:5221455-5221477 GCTGGAATTTAGGCACAGTCTGG - Intronic
1166131268 19:40747131-40747153 GCTGGTAAGAAGGCAAGGTTCGG + Intronic
1168110568 19:54189476-54189498 CCGGGGAAGAAGCCACGGTCAGG + Exonic
1168110621 19:54189674-54189696 TCTGGAAAGGAGGCGGGGTCTGG + Exonic
927531093 2:23802375-23802397 TGTGAAAAGAAGGCACTGTCTGG + Intronic
929261566 2:39871958-39871980 GCTGGAAAGAAGACTTCGTCTGG + Intergenic
929808718 2:45170132-45170154 GCTGGAAAGCCGGGAAGGTCTGG - Intergenic
930873629 2:56190815-56190837 GGAGGAAAGAAGGGAGGGTCAGG - Intronic
931620299 2:64203759-64203781 GCTGGAAAGGGGGCTGGGTCAGG - Intergenic
934295327 2:91738369-91738391 ACTGGAAGGAAGCCACAGTCTGG - Intergenic
937254495 2:120545628-120545650 GCTGGAAAGACGCTAGGGTCTGG - Intergenic
940520312 2:154737138-154737160 GCTGGAAATCAGGCAAGGCCAGG + Intronic
942483066 2:176410242-176410264 AGGGGAAAGAAGGCACGGTGTGG - Intergenic
944282324 2:197912108-197912130 GCTGGGAAGAAGGTGCTGTCTGG + Intronic
944354963 2:198776776-198776798 GCTGGAAAAAAGCCACGGGTGGG - Intergenic
947815872 2:233036357-233036379 GCAGGAAGTAAGGCATGGTCTGG + Intergenic
948542187 2:238698967-238698989 GCTGGAGAGCAGGCACAGCCAGG + Intergenic
1170598151 20:17820938-17820960 GATGGAAACAAGGCAGGGTCTGG + Intergenic
1171213865 20:23337592-23337614 GCTGGAAAGAGGACATGGACAGG - Intergenic
1171511061 20:25685424-25685446 ACTGGAAGGAAGGCAGGGCCAGG + Intronic
1171903256 20:30876787-30876809 GTTAGAAAGAACGCAAGGTCAGG - Intergenic
1173272698 20:41552822-41552844 GTTGGAAAGCAGGCATGATCGGG + Intronic
1173947826 20:46965581-46965603 GCTGGGAAGAAGGCACGCTTAGG - Intronic
1175767844 20:61603488-61603510 GCTGGAAGGGAGGCAGGGCCAGG + Intronic
1179566227 21:42250813-42250835 GCTGGCATGGAGGCAGGGTCAGG + Intronic
1180016634 21:45090500-45090522 GCTTGAAATAGGGCACGGTAGGG - Intronic
1180336656 22:11582759-11582781 GTTAGAAAGAATGCAAGGTCAGG - Intergenic
1180943660 22:19677628-19677650 GCTGGGAAGAGGGGACGGTGGGG + Intergenic
1181639090 22:24187493-24187515 ACTGGAAACATGGCACGGGCAGG + Intronic
1181870101 22:25891250-25891272 GCTGGACAGAAGACATGGGCTGG - Intronic
1183295252 22:37025383-37025405 GGTGGAATGAAGGCAGAGTCGGG + Intronic
951924186 3:27888821-27888843 GCTAGTAATAAGGCAAGGTCTGG + Intergenic
952414747 3:33080726-33080748 GGTGGAAAGAAGGGACAGCCTGG - Intronic
953770861 3:45777825-45777847 CCTGGGAAGCAGGCCCGGTCTGG - Intronic
954156409 3:48687279-48687301 GGTGCAGAGAAGGCAGGGTCTGG - Intergenic
955000043 3:54919179-54919201 GCTGACAAGAAGGCACGCTGGGG + Intronic
955334750 3:58075922-58075944 GCTGCAGAGAAGGCAAGGGCAGG + Intronic
960737824 3:120799792-120799814 GCTGGAAGCAAGGCACTGCCAGG - Intergenic
961288835 3:125828838-125828860 GCTGGAGAGGCGGCAGGGTCAGG + Intergenic
962157381 3:132962246-132962268 GCTAGAAAGAAGTCAATGTCTGG - Intergenic
962840110 3:139225491-139225513 GCTGGGAGCAAGGCAAGGTCTGG - Intronic
964176152 3:153827518-153827540 GCTGGAGCGAAGGCATAGTCAGG - Intergenic
964754992 3:160084724-160084746 GATGGTAAGAAGTTACGGTCAGG - Intergenic
966916675 3:184588068-184588090 GCTGGGAAGAAGGCAGGAGCAGG - Intronic
969180156 4:5434197-5434219 GCAAGAAAGCAGGCACTGTCAGG + Intronic
969338814 4:6527845-6527867 CCTGGACAGAAGGCAGGGCCTGG + Intronic
970336834 4:15055727-15055749 GCTAGAAAGAAGGCAAGGCCAGG - Intronic
970899510 4:21142650-21142672 GCTGGCAGGAAGGCAAGGGCGGG - Intronic
974152968 4:58033174-58033196 GGTGGAAATAAGGCAAGGTGAGG + Intergenic
976111733 4:81682636-81682658 GATGAAAAGAAGGCACGTACTGG + Intronic
983932248 4:173465311-173465333 TCTGGAAAAAAGGGAAGGTCAGG - Intergenic
993013298 5:82508324-82508346 GCTGGCAGGAAGGCCCTGTCAGG + Intergenic
993407159 5:87526007-87526029 GCTGGAAAACAGGCAGGGTCTGG - Intergenic
993860816 5:93134856-93134878 AATGGAAAGAAGGCATGGTTGGG - Intergenic
995436470 5:112141840-112141862 GCTGGGAAGAAAGCAAGATCAGG - Intergenic
997243822 5:132329238-132329260 GGAAGAAAGAAGGCACTGTCAGG - Intronic
997255293 5:132423714-132423736 GCTGGCAAGGTGGCAAGGTCTGG - Intronic
997457411 5:134027436-134027458 GCTGGAAGGAAGGCAGGGAGGGG - Intergenic
997677604 5:135724851-135724873 ACTGGAAAGAAGGCAGTGACTGG + Intergenic
997694771 5:135852255-135852277 GCTGGAAAGAAGTCAGGCTGTGG - Intronic
999319649 5:150605554-150605576 GCTGGGAAGGAGGCCCTGTCCGG - Intronic
1002788304 6:420443-420465 CCTGGAAAGCAGGGAGGGTCAGG - Intergenic
1003157448 6:3608456-3608478 GCTGGAAAGCAGGGAGGGTTTGG - Intergenic
1005659761 6:27984680-27984702 GCTGGGAAAAAGGGACTGTCTGG - Intergenic
1006107184 6:31723790-31723812 GCTGGAGGGGAGGCACGGTGGGG - Exonic
1006443438 6:34065916-34065938 GCTGGAAAGCAGTCAGGGGCTGG - Intronic
1006609964 6:35288547-35288569 GCTGGAAGGAAGGAACGTGCAGG - Intronic
1007228426 6:40330781-40330803 TCTGGAAAGAAGCCATGGGCTGG - Intergenic
1008496109 6:52136154-52136176 GGTGGACAGAAGGCATGGACAGG + Intergenic
1010786338 6:80004951-80004973 GCTGGAAAGAAGGGGTGGTGGGG + Intronic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1016022359 6:139249511-139249533 GCTGGAAGGAAGGCACCGACCGG + Intronic
1023689427 7:42770765-42770787 GCAGAAAAGAAGTCACTGTCTGG - Intergenic
1028024210 7:85816601-85816623 GTAGGAAAGATGGAACGGTCTGG - Intergenic
1029452434 7:100648662-100648684 CCTAGAAGGAAGGCACTGTCAGG + Exonic
1029786341 7:102795360-102795382 GGTGGAAAGAAGGCAGGGAGAGG + Intronic
1031155729 7:118109300-118109322 GCAGGAATGAAGGCAGGTTCAGG + Intergenic
1032557705 7:132854837-132854859 TCTGGAAAGAAGGGAGGCTCTGG + Intronic
1034491195 7:151393985-151394007 TCAGGAAAGAAGGGAAGGTCAGG - Intronic
1035726896 8:1830318-1830340 GCTGGACAGAAGCCACGCCCAGG - Intronic
1036241499 8:7085402-7085424 GCTGGCAAGAAGGCACAGGGAGG + Intergenic
1037487412 8:19361282-19361304 GCTGGAAAGAAGACTCGGAATGG + Exonic
1038130406 8:24724235-24724257 GCTAGAGAGAAGTCAAGGTCTGG + Intergenic
1039421932 8:37450566-37450588 GCTGGGAAGAAGGGAGAGTCAGG + Intergenic
1041820589 8:62028206-62028228 GCTGGAATGAGGGCAAGGTTGGG - Intergenic
1042953909 8:74228190-74228212 ACTGGCAAGAAGGCACAGACTGG - Intergenic
1044357018 8:91234531-91234553 GCTGAAAAGAAGGCAAAGACAGG - Intronic
1046906081 8:119574439-119574461 TGTGGAATGAAGGCTCGGTCTGG - Intronic
1049345457 8:142136265-142136287 GCTGGGAAGAGAGCACGGCCTGG - Intergenic
1049579801 8:143406178-143406200 GCTGGCAAGCAGGAGCGGTCAGG - Intergenic
1049677011 8:143894450-143894472 GCTGGAGAGAAGCCACTGTTTGG - Intergenic
1051606685 9:18923752-18923774 CCTGGAATGAAGACACGGCCAGG + Intergenic
1053287897 9:36861712-36861734 GCTGGAGAGAAGCCAGGGTGGGG + Intronic
1053456167 9:38234594-38234616 GCAGGAAAGCAGGCAGAGTCAGG - Intergenic
1056708188 9:88969263-88969285 GCAGGGAGGAAGGCACCGTCTGG + Intergenic
1057596328 9:96418481-96418503 GCTGGAAAGAAGGCCAGGCCTGG - Intergenic
1057754531 9:97821424-97821446 GCAGGTAAGAAGGCATGGTGGGG + Intergenic
1059238685 9:112784508-112784530 GCAAAAAAGAAGGCACGGGCAGG - Intronic
1061631058 9:131872466-131872488 GCTGGAGGGAAGCCACAGTCTGG - Intronic
1062189851 9:135242384-135242406 GCTGGAAAGGAGGCGAGGGCTGG - Intergenic
1185848992 X:3467861-3467883 ACTGGAAAGAAGTCAGGATCTGG - Intergenic
1187479398 X:19641185-19641207 GCTGGTAAGAAGAGAGGGTCTGG + Intronic
1187827697 X:23348534-23348556 TCTTGAAAGAAGCCAGGGTCGGG + Intronic
1188469259 X:30518713-30518735 GCTGGAAAGAAGTCAATGCCTGG + Intergenic
1192224223 X:69217351-69217373 GCTGGAAAGAAGGCCAGGGCAGG - Intergenic
1192267082 X:69546482-69546504 GCCGTAGAGGAGGCACGGTCAGG + Intergenic
1197258874 X:124294551-124294573 GCTGTAAAGGAGGCATGGTTGGG - Intronic
1199461407 X:148089751-148089773 GCTGGAAAGAAGACAGGTACCGG + Intergenic