ID: 1083182497

View in Genome Browser
Species Human (GRCh38)
Location 11:60996271-60996293
Sequence CCCACTGCTCTGATAGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083182497_1083182502 17 Left 1083182497 11:60996271-60996293 CCTTTCCCTATCAGAGCAGTGGG 0: 1
1: 0
2: 1
3: 16
4: 184
Right 1083182502 11:60996311-60996333 TCCCTTATCCCCCTGCACTCTGG 0: 1
1: 1
2: 1
3: 20
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083182497 Original CRISPR CCCACTGCTCTGATAGGGAA AGG (reversed) Intronic
900465838 1:2825073-2825095 CCCTCTGGTCTGATGGGGAGGGG + Intergenic
900760572 1:4467520-4467542 CCCACACCTCAGACAGGGAAGGG - Intergenic
903557874 1:24206438-24206460 ACCACTTCTCTTATGGGGAAGGG - Intergenic
903607227 1:24583928-24583950 TCCACTGTGCTGATAGGAAACGG - Intronic
904112415 1:28136569-28136591 CCCACTGGGCTGATAAGGGAGGG + Intergenic
904126820 1:28246575-28246597 CCAAGTGCTCTGAAATGGAAAGG - Intronic
904594477 1:31634693-31634715 TACAATGCTCTTATAGGGAAGGG - Intronic
907026927 1:51129254-51129276 CCCAGTGCTCTGAGAGGCCAAGG - Intronic
907081413 1:51626276-51626298 ACCTCTTCTATGATAGGGAAAGG - Intronic
907093267 1:51749559-51749581 CCCACTGCTTTGGTAGGCCAAGG - Intronic
908432481 1:64072668-64072690 CCCACAGGTCTGCCAGGGAATGG + Intronic
909332351 1:74428682-74428704 CCCAGTGCTCTGAGAGGCCAAGG + Intronic
911070217 1:93826392-93826414 CCAGCTGCTGTGATGGGGAAGGG - Intronic
915119373 1:153619131-153619153 GCCACTGCTCTCTGAGGGAAGGG - Intronic
915455029 1:156034731-156034753 CCCAATGGTCTGATGGGGAATGG + Intergenic
917703085 1:177600905-177600927 CCCACTGGTCTGACATGGCATGG - Intergenic
918960213 1:191266024-191266046 GACACTGCTCTAATAGGGGAAGG + Intergenic
919651833 1:200157026-200157048 CCCAGTGCTATTATAAGGAAAGG - Intronic
920960289 1:210657450-210657472 GCCACTGCTCTGGAAGGGGAAGG - Intronic
1062960565 10:1570622-1570644 CCCACTGCTGTGACAGGCCAGGG - Intronic
1064145943 10:12826580-12826602 GCCACTGCTCTGATGTGGAGAGG - Intronic
1065206338 10:23360989-23361011 ACCACTTCTCAGATAGGGAACGG - Intergenic
1066127503 10:32356338-32356360 TTCCCTGCTCTGAAAGGGAAGGG - Intronic
1069126128 10:64636638-64636660 AGCACTGCTGTGCTAGGGAATGG + Intergenic
1069296263 10:66848399-66848421 CCCACTTGTCTGACAGTGAAGGG + Intronic
1070731628 10:78832426-78832448 CCCACTTCTCTTTAAGGGAATGG - Intergenic
1070744993 10:78928345-78928367 CCAACTGCTTGGATAGGAAAGGG - Intergenic
1070789924 10:79182920-79182942 CTCACTGCTCAGATGGTGAAGGG - Intronic
1072917167 10:99545107-99545129 CCCACTCTTCTGAGAAGGAAGGG + Intergenic
1073611948 10:104953071-104953093 CCCACTGCTCTGTCAGAGAGTGG - Intronic
1074069567 10:110052400-110052422 ACCACTGATCTGATAGGAAGTGG - Intronic
1076381945 10:130029428-130029450 CCCACTGCAGTGCCAGGGAAGGG + Intergenic
1082742133 11:56922718-56922740 CAAATAGCTCTGATAGGGAAAGG - Intergenic
1083159676 11:60847451-60847473 CACACTGTTCTGAAATGGAATGG + Intronic
1083182497 11:60996271-60996293 CCCACTGCTCTGATAGGGAAAGG - Intronic
1084311259 11:68317520-68317542 CCCACTACCCAGGTAGGGAACGG - Intronic
1084463994 11:69311607-69311629 CCCACTGCTCTGCTAGGTGGAGG + Intronic
1084904679 11:72336386-72336408 CCCAGTGCTCTCAGAGGGAAGGG - Intronic
1089261999 11:117229834-117229856 TCCACTGCTCTGATGCCGAAGGG - Exonic
1090872673 11:130762131-130762153 CCAACTGCTCCAATAGGAAAAGG + Intergenic
1091558249 12:1592533-1592555 CCCACTGCTGTGACTGGAAATGG - Intronic
1096829224 12:54301322-54301344 CCCACGGCTCTCCTAGGGACAGG + Intronic
1097309706 12:58105212-58105234 ACCACTGCTTTGATAGCGGAAGG + Intergenic
1097764072 12:63503520-63503542 CCCATTGGGATGATAGGGAAAGG - Intergenic
1098448471 12:70592169-70592191 TCCACTTCTCAGATTGGGAAAGG + Intronic
1100956457 12:99914667-99914689 ATCAGGGCTCTGATAGGGAAAGG + Intronic
1101837953 12:108308276-108308298 GCCACTGCATTAATAGGGAAAGG + Intronic
1103617921 12:122166784-122166806 CGCACTGCTCTTACAGGGAGAGG - Intergenic
1103733058 12:123041503-123041525 CACACTGCTCTGATACGGGAGGG - Intronic
1104033406 12:125081320-125081342 CCCACTGCAATTATAAGGAAGGG - Intronic
1105296066 13:19088916-19088938 CACACTGCTCTGAGGGGGCAAGG - Intergenic
1105972204 13:25439658-25439680 CCCAGTGCTCTGAGAGGCCAAGG + Intronic
1109442176 13:62389422-62389444 TACACTGCTTTGACAGGGAATGG + Intergenic
1109622599 13:64928824-64928846 ACCACTGCTCTGATAGGAGGTGG + Intergenic
1111172088 13:84540992-84541014 CCCACTTCTCTGACAGGTAGAGG + Intergenic
1113062049 13:106332508-106332530 CACACTTCACTGGTAGGGAATGG - Intergenic
1119294468 14:73521901-73521923 ACCACTGCTCTTAAAGGGATTGG - Intronic
1121948200 14:98143736-98143758 CCCTCTGCTCTGATGGTGTAGGG + Intergenic
1125885326 15:43225379-43225401 CCCATTGCTCTCCTAGGTAAGGG - Intergenic
1126176485 15:45740577-45740599 CCCACTTGTCTCACAGGGAAGGG - Intergenic
1127060467 15:55177502-55177524 CCCAGTGCTTTGAGAGGCAAAGG - Intergenic
1127078789 15:55354344-55354366 CTTTCTGCTCTGATAGGGGATGG - Intronic
1127483722 15:59400405-59400427 ACCACTGCTATGATCGGGAGAGG - Intronic
1127796350 15:62441717-62441739 CCCACTGCTGGGAAAGGGAGAGG + Intronic
1128725274 15:69983365-69983387 CCCAGAGCTCTGCTAGGCAAGGG - Intergenic
1131068015 15:89446497-89446519 CTCCTTGCTCTGATAGAGAAAGG + Intergenic
1131510647 15:93047871-93047893 CAAGCTGCTCTGATGGGGAAGGG + Intronic
1133152775 16:3849354-3849376 CCAAGAGCTCTGCTAGGGAAAGG - Intronic
1135182917 16:20291017-20291039 CCATGAGCTCTGATAGGGAAGGG - Intergenic
1135326236 16:21527455-21527477 CCCGCTCCTCTGGTGGGGAAGGG - Intergenic
1137581985 16:49639165-49639187 GCCACTTTCCTGATAGGGAAAGG + Intronic
1138389306 16:56658538-56658560 TCCTCTGCTCTGAGTGGGAAAGG + Intronic
1138390551 16:56667488-56667510 TCCTCTGCTCTGAGTGGGAAAGG - Intronic
1139322615 16:66127645-66127667 CCACCTGCACTGATGGGGAAGGG + Intergenic
1140781557 16:78301612-78301634 CCCACGGCTCTGAGCTGGAAAGG + Intronic
1141582027 16:85006111-85006133 CCCAGTGCTTTGAGAGGCAAAGG + Intronic
1142039285 16:87882182-87882204 CCCGCTCCTCTGCTGGGGAAGGG - Exonic
1143110862 17:4552073-4552095 CCCACTTCACGGACAGGGAAGGG + Intronic
1143272270 17:5684540-5684562 CCCAGTGCTTTGATAGGCCAAGG - Intergenic
1144595640 17:16568421-16568443 CCCAACCCTCTGATAGTGAAAGG - Intronic
1146461197 17:33047220-33047242 CCCTCAACTCTGAGAGGGAAGGG - Intronic
1148099792 17:45082087-45082109 CCCACCGCTCTGACAATGAAAGG + Intronic
1148565611 17:48631347-48631369 CCCACTGTCCTGATAAGCAAAGG - Intronic
1148884665 17:50763390-50763412 CACACTGCTCAGAAAGGTAAGGG - Intergenic
1149350960 17:55786826-55786848 CCCATTGCTCTCATTGGAAACGG - Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150207987 17:63423528-63423550 CATTCTGCTCTGTTAGGGAAGGG + Exonic
1151623380 17:75261377-75261399 CCCGGCGCCCTGATAGGGAAGGG + Intronic
1151938366 17:77277931-77277953 CCCACTCCTATGAAAGGGGAGGG - Intergenic
1152234741 17:79132814-79132836 CCAACTCCTCTGAGAGGTAAGGG + Intronic
1160131626 18:76230550-76230572 CTCACTGCTCTGGAAGGGTAGGG + Intergenic
1160553312 18:79709877-79709899 CCCACTGCTCTCATCTGTAATGG - Intronic
1161003444 19:1922779-1922801 CCCACTGCTGCGATGGTGAAGGG + Intronic
1162057128 19:8071489-8071511 CCCAAGGCTCAGACAGGGAAGGG + Intronic
1163280785 19:16315932-16315954 CCCAGTGCTTTGATAGGCAAGGG + Intergenic
1165146490 19:33734480-33734502 CCCATTGCTGTTATAGGGAAGGG - Intronic
1165393597 19:35551834-35551856 CCGACTGCTTTCATAGTGAAAGG + Intronic
1167439283 19:49499199-49499221 CCTGCTGCTCTGCTGGGGAAGGG + Intronic
925745560 2:7040620-7040642 CCCACTGCTTTGCTCGGCAATGG + Exonic
928645419 2:33347217-33347239 CCTTCTGCTCTTTTAGGGAAGGG - Intronic
929296804 2:40257649-40257671 CACACTGCTTTGAAAGGGAAGGG - Intronic
929905682 2:46044317-46044339 CCCAGTGATCTGTTAGAGAAAGG + Intronic
930675609 2:54197407-54197429 CTCACTACTCTTATAGGTAAAGG - Intronic
932605602 2:73163352-73163374 CCTACTGCTCTCCTAGGGGAGGG + Intergenic
932606046 2:73166363-73166385 CCCACTCCTCAGCTGGGGAAAGG + Intergenic
933224179 2:79726428-79726450 CCCACTGCTCTGACAGGAGGCGG - Intronic
933727051 2:85433085-85433107 CACCCTGCTCTGAAAGGAAAAGG - Intronic
933926381 2:87094088-87094110 CCCACTCCTCAGCTGGGGAAAGG - Intergenic
937994099 2:127680019-127680041 CCCAGTGCCCTGAAAGGGACAGG - Intronic
939306088 2:140414164-140414186 CCCAGTGCTTTGAAAGGTAAAGG - Intronic
942380091 2:175381756-175381778 CCCACTGATCTTCTAGGGCATGG - Intergenic
948944650 2:241213319-241213341 CCCACTGTGCTGATGGGGAGAGG - Intronic
1170101694 20:12708336-12708358 CCCACTGTTCTTATTTGGAATGG + Intergenic
1171055649 20:21903912-21903934 AGACCTGCTCTGATAGGGAAGGG - Intergenic
1172125498 20:32623013-32623035 CCCACTCCTCTCCTAGGGAAGGG + Intergenic
1173724346 20:45286972-45286994 CCCACAGCCCTGAGAGAGAAGGG + Intergenic
1174281942 20:49445803-49445825 CTCCCTGCTCTGGCAGGGAAAGG + Intronic
1174304971 20:49608552-49608574 CCCGCTTCTCTGACATGGAAAGG + Intergenic
1174421007 20:50399181-50399203 CCCACAGCCCTGCTTGGGAAAGG + Intergenic
1175475743 20:59272884-59272906 CCCACTGCTCTGACAGAGCTGGG - Intergenic
1179378301 21:40873414-40873436 GCTGCTGATCTGATAGGGAACGG + Intergenic
1180693511 22:17737594-17737616 CCCACTGCTCTGGGAGGCCAAGG - Intronic
1182652391 22:31862674-31862696 CCCACTGCACTGGGAGGGTAAGG + Intronic
1185220709 22:49627873-49627895 CACACTGCCCTCACAGGGAAGGG + Intronic
950280962 3:11707597-11707619 CCCAGTGCTCTGAGAGGCCAAGG + Intronic
953600362 3:44357152-44357174 CCCATTGCTTTGAGAGGGTAAGG + Intronic
953832426 3:46312076-46312098 GACACTGCTCTGGCAGGGAAAGG + Intergenic
954014649 3:47676757-47676779 CCCACTGCTCTAAAAAGGCATGG + Exonic
955478658 3:59366570-59366592 CACACTGCCCTTATATGGAAGGG + Intergenic
959963763 3:112331820-112331842 CCCACTGCTTTGGGAGGCAAAGG + Intergenic
961090945 3:124112353-124112375 CCTTCTGCCCTGCTAGGGAAGGG - Intronic
962496519 3:135945550-135945572 CCAATTGGTCTCATAGGGAAAGG + Intergenic
962847717 3:139286299-139286321 CCCACTGCTCTGGTGTAGAATGG + Intronic
962990847 3:140575968-140575990 CCCACTGCTTTGAGAGCTAACGG - Exonic
964514470 3:157493047-157493069 CCCCCACCACTGATAGGGAAGGG + Intronic
966116323 3:176467654-176467676 CTCACTGCTGAGATAGAGAAAGG + Intergenic
967097927 3:186193067-186193089 CCCACTGCGGTAATAGGGGAAGG - Intronic
968547501 4:1206392-1206414 ACCACTGCTCTGCCAGGGCAGGG + Intronic
968745461 4:2357551-2357573 CCTACTGCTCTGAAGGGGAGCGG - Intronic
969527403 4:7710882-7710904 CCCACTCCTCTGAGAAAGAATGG + Intronic
970209450 4:13693724-13693746 TCCACTGCTAGGATTGGGAAGGG + Intergenic
970316693 4:14834764-14834786 CTCACTGCACTAATAGTGAAGGG + Intergenic
971139742 4:23911243-23911265 CCCAGTGCTATGCTAGGGACAGG - Intergenic
973018104 4:45166668-45166690 ACCACTGATCTGACAGGGAGTGG + Intergenic
975873324 4:78806426-78806448 CCCAGTGCTCTGGTAGGCCAAGG - Intronic
978041003 4:104061867-104061889 ACCTGTGCTCTGATAGGGAAGGG - Intergenic
982724324 4:158889494-158889516 CCCACTGCAGTGGTAGGGAAGGG - Intronic
983265547 4:165504350-165504372 CCCACTCCCCTAAGAGGGAAAGG + Intergenic
983353640 4:166627947-166627969 CCCAGTGCTTTGAGAGGCAAAGG + Intergenic
985191571 4:187380318-187380340 CTTACTGCTCTGATATAGAAAGG + Intergenic
986728623 5:10618479-10618501 GCCACGGCTCTGAGAGGAAAGGG - Intronic
988590135 5:32541509-32541531 GCCACTGCTCTGAGAGGTACTGG - Intronic
990470602 5:56111743-56111765 CCGACTGCTCTGGGAGGGAGGGG + Exonic
991456100 5:66806244-66806266 CTCCCTGCTCTGACAGGGTAAGG - Intronic
991903577 5:71485012-71485034 ACCACTTCTCTAATATGGAATGG - Intronic
996814269 5:127557312-127557334 ACCACTGCTCTGATAAAAAAAGG + Intergenic
999285733 5:150393241-150393263 CACTCTGCACTGATAGGGCAGGG + Intronic
1003103435 6:3195090-3195112 CCCACTCCCCTGATAGGCAAAGG + Intergenic
1004050002 6:12067766-12067788 ACAACTGCTCTGGTAGGGAAGGG + Intronic
1006524008 6:34588614-34588636 CCCTCTGCTCTGCTAGGGAGTGG + Exonic
1007185434 6:39967142-39967164 GACACTGCACTGATAGGGGAAGG - Intergenic
1007282219 6:40721014-40721036 GCCACTGCTCAGATGGGAAAAGG + Intergenic
1008663753 6:53696070-53696092 CCCAATGCTTTTATAAGGAAAGG - Intergenic
1009390750 6:63140471-63140493 CCCACTGCCCTGAAATGGCAAGG + Intergenic
1016190743 6:141261395-141261417 CCCACCAGTCTGAGAGGGAAAGG + Intergenic
1023978395 7:45051033-45051055 CCCACTGCTCTGAGGGTGGATGG - Intronic
1030912594 7:115270370-115270392 CCCAGTGCTTTGAGAGGGTAAGG - Intergenic
1031471632 7:122174704-122174726 CCCACTCCTTTGTTAGGGAGAGG + Intergenic
1031538602 7:122965143-122965165 TCCACTTCTCTGATAGTAAATGG + Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032274504 7:130442262-130442284 CTCACTCCTCTGCTAAGGAAGGG + Intronic
1033514009 7:142088097-142088119 GGCACAGCTCTGATAGGGTAGGG + Intronic
1035932993 8:3805094-3805116 CCCACTGTTATGAATGGGAAGGG + Intronic
1036503438 8:9334349-9334371 CCCATTGCTTTCAAAGGGAAGGG - Intergenic
1037926725 8:22849395-22849417 CCCACTGCACAGGCAGGGAAAGG + Intronic
1038749929 8:30285642-30285664 CCCAGTGCTCTGAGAGGCCAAGG + Intergenic
1039382455 8:37099081-37099103 CCCAAATCTCAGATAGGGAAAGG - Intergenic
1040699418 8:50042845-50042867 CCCACTGCTTTGAGAGGCTAAGG - Intronic
1040825472 8:51616001-51616023 GCCATTGCTCTGATAGAGAAAGG - Intronic
1040917613 8:52579691-52579713 CCCTCTGCGCTGACAGGGTAAGG - Intergenic
1045946812 8:107805574-107805596 CCTTCAGCTCTGCTAGGGAAAGG - Intergenic
1046685800 8:117225534-117225556 ACCACTGCTCAGATAGGGAAGGG + Intergenic
1048862396 8:138733596-138733618 CCCACTGCTCTTTCAGGGATAGG + Intronic
1049642406 8:143721602-143721624 CAAACTGCTCTCCTAGGGAATGG + Exonic
1052169246 9:25373753-25373775 CCCACTGCTTTGAGAGGCCAAGG + Intergenic
1055399240 9:75905691-75905713 CCCACTGATCTGACAGGAAGTGG - Intronic
1057263720 9:93600436-93600458 CACACTGCTTTGAGGGGGAAAGG + Intronic
1057460164 9:95253949-95253971 GCCACTGATCTGACAGGGAGCGG + Intronic
1186013864 X:5168431-5168453 CCCAGCGCTTTGAGAGGGAAAGG - Intergenic
1186024533 X:5294889-5294911 CCCACTGCTTTGGGAGAGAAAGG + Intergenic
1186807030 X:13150217-13150239 CTCACTGCTGTGATAAGGACGGG - Intergenic
1187175975 X:16896818-16896840 CCTAGTGCTCTGATAGGCACTGG + Intergenic
1189260742 X:39677163-39677185 CCCACTGGACTCAAAGGGAAGGG + Intergenic
1189377724 X:40478736-40478758 CCCACTGCTCTGATTTGGGTGGG - Intergenic
1191873026 X:65765720-65765742 CCAGCTCCTCTCATAGGGAATGG - Intergenic
1197525196 X:127552978-127553000 CCAACTGCTGTGGCAGGGAAGGG + Intergenic
1197645735 X:129014722-129014744 CCCACTGGACTGCTAGGTAATGG + Intergenic
1198375374 X:136033616-136033638 TCCACAGCACTGATGGGGAAAGG - Intronic
1198492024 X:137151538-137151560 GACACTGCTCTGGCAGGGAAAGG + Intergenic
1200802963 Y:7403016-7403038 TCCAATGGTTTGATAGGGAAAGG + Intergenic
1201646026 Y:16232741-16232763 CCCACTGCTTTGGTAGAGAAAGG - Intergenic
1201656787 Y:16352572-16352594 CCCACTGCTTTGGTAGAGAAAGG + Intergenic